Resources Contact Us Home
Browse by: INVENTOR PATENT HOLDER PATENT NUMBER DATE
 
 
Nucleic acids encoding an endometrial bleeding associated factor (EBAF)
RE40937 Nucleic acids encoding an endometrial bleeding associated factor (EBAF)

Patent Drawings:
Inventor: Tabibzadeh, et al.
Date Issued: October 13, 2009
Application: 11/801,427
Filed: May 9, 2007
Inventors: Tabibzadeh; Siamak (Albertson, NY)
Kothapalli; Ravi (Wesley Chapel, FL)
Assignee: University of South Florida (Tampa, FL)
Primary Examiner: Myers; Carla
Assistant Examiner:
Attorney Or Agent: Saliwanchik, Lloyd & Saliwanchik
U.S. Class: 536/23.5; 536/23.1; 536/24.31
Field Of Search:
International Class: C07H 21/02; C07H 21/04
U.S Patent Documents:
Foreign Patent Documents: WO 99/06443; WO 99/06444; WO 99/55902; WO 01/01134
Other References: Kosaki et al. American Journal of Human Genetics. 1999. 64: 712-721. cited by examiner.
GeneCard for ebaf/lefty2, available via url:<genecards.org/cgi-bin/carddisp.pl?gene=LEFTY2>. cited by examiner.
"DNA Sequencing by the Dideoxy Method," Sequences Ver. 2.0 A New Genetically Engineered Enzyme for DNA Sequencing, U.S. Biochemical Corp., 1988-89, pp. 7-29-7-35. cited by other.
Brown "Analysis of RNA by Northern and Slot Blot Hybridization" Current Protocols in Molecular Biology, Unit 4.9, 1993, pp. 4.9.1-4.9.14. cited by other.
Liang et al. "Differential Display Using One-Base Anchored Oligo-dT Primers" Nucleic Acids Research, 1994, pp. 5763-5764, vol. 22, No. 25. cited by other.
Tabibzadeh et al. "Distinct Tumor Specific Expression of TGFB4 (ebaf), a Novel Human Gene of the TGF-B Superfamily" Frontiers in Bioscience 2, Jul. 1997, pp. 18-25. cited by other.
Tabibzadeh et al. "Dysregulated Expression of ebaf, a Novel Molecular Defect in the Endometria of Patients with Infertility" The Journal of Clinical Endocrinology& Metabolism, Mar. 8, 2000, pp. 2526-2536, vol. 85, No. 7. cited by other.
Tabibadeh et al. "Temporal and Site-Specific Expression of Transforming Growth Factor-.beta.4 in Human Endometrium" Molecular Human Reproduction, 1998, pp. 595-602, vol. 4, No. 6. cited by other.
"Radioimmunoassay", http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/R/Radioimmunoassay- .html, Mar. 2005, pp. 1-3. cited by other.
Lennard, S.N., et al., "Transforming growth factor beta 1 expression in the endometrium of the mare during placentation" Molecular Reproduction and Development, 1995, pp. 131-140, vol. 42. cited by other.
Wieczorek, Z., et al., "The immunomodulatory diversity of the proteins of the transforming growth B (TGFB) family" International Journal of Peptide and Protein Research, Jul. 1995, pp. 113-118, vol. 46. cited by other.
Burt, D.W., et al., "Multiple growth factor mRNAs are expressed in chicken adipocyte precuror cells" Biochemical and Biophysical Research Communications, Sep. 30, 1992, pp. 1298-1305, vol. 187, No. 3. cited by other.
Bowie, James U., et al., "Deciphering the Message in Protein Sequences: Tolerance to amino acid substitution" Science, Mar. 16, 1990, pp. 1306-1310, vol. 247. cited by other.
Meno, et al., "Left-right asymmetric of the TFG.beta.--family member lefty in mouse embryos" Nature1996, pp. 151-155, vol. 381. cited by other.
Sporn, M.B., et al., "TFG.beta.: problems and prospects", Cell Regulation, The American Society of Cell Biology, Nov. 1990, pp. 875-882. cited by other.
Roberts, A.B., "Transforming growth factor .beta.: multifunctional regulator of differentation and development", Phil. Trans. R. Soc. Lond. B, 1990, pp. 145-154, vol. 327. cited by other.
Burt, David W., et al., Correction: A New Interpretation of a Chicken Transforming Growth Factor--.beta.4 Complementary DNA, Molecular Endorcrinology, pp. 989-992, vol. 6, No. 6. cited by other.
Flanders, Kathleen C., et al., "Antibodies to peptide determinants in Transforming Growth Factor B and their Applications" Biochemistry1988, pp. 739-746, vol. 27. cited by other.
Postlethwaite, A.E., et al., "Identification of a chemotactic Epitope in Human Transferring Growth Factor-.beta.1 Spanning Amino Acid Residues 368-374", Journal of Cellular Physiology, 1995, pp. 587-592, vol. 164. cited by other.
Teicher, B.A., et al., "Transforming growth factor--.beta.in vivo resistance", Cancer Chemther Pharmacol1996, pp. 601-609, vol. 37. cited by other.
Newcom, Samuel, R., et al., "Production of Monoclonal Antibodies That Detect Hodgkin's High Molecular Weight Transforming Growth Factor--.beta." Blood, Jun. 15, 1990, pp. 2434-2437, vol. 75, No. 12. cited by other.
Dillner, J., et al., "Antibodies Against a Synthetic Peptide (Gly-Ala)" PNAS, Aug. 1984, pp. 4652-4656, vol. 18. cited by other.
Oosterlynck, D.J., et al., "Transforming growth factor B activity is increased in peritoneal fluid from women with endometriosis" Obstet. Gynecol, Feb. 1994, pp. 287-292, vol. 83, No. 2. cited by other.
Ayala, A., et al., "The release of transforming growth factor B following hemorrhage: its role as a mediator for host immunosuppression" Immunology, 1993, pp. 479-484, vol. 79. cited by other.
Hoefer, M., et al., "Anti (transforming growth factor B) antibodies with predefined specificity inhibit metastasis of highly tumorigenic human xenotransplants in nu/nu mice" Cancer Immunol Immunother, 1995, pp. 302-308, vol. 41. cited by other.
U.S. Appl. No. 11/801,428, filed May 9, 2007, Tabibzadeh. cited by other.
RNA Image Kit Product Brochure, 1993, pp. 1-21. cited by other.
"DNA Sequencing by the Dideoxy Method," Sequences Ver. 2.0 A New Genetically Engineered Enzyme for DNA Sequencing U.S. Biochemical Corp., 1988-89, pp. 7-29-7-35, p. 7.29 only. cited by other.
Analysis of RNa by Northern and Slot Blot Hybridization, Current Protocols in Molecular Biology, Unit 4.9, Unit 4.9, 1993, pp. 4.9.1-4.9.14, p. 4.9.1 only. cited by other.
Hillier et al. Genbank Accession No. R37562, May 1995. cited by other.
Frigerio et al. Genbank Accession No. T25016, May 1995. cited by other.
Liang et al. "Differential Display Using One-Base Anchored Oligo-dT Primers" Nucleic Acids Research, 1994, pp. 5763-5764, vol. 22, No. 25. p. 5763 only. cited by other.
Tabibzadeh et al."District Tumor Specific Expression of TGFB4 (ebaf), a Novel Human Gene of the TGF-B Superfamily" Frontiers in Bioscience 2, Jul. 1997, pp. 18-25. p. 18 only. cited by other.
Tabibzadeh et al. "Dysregulated Expression of ebaf, a Novel Molecular Defect in the Endometria of Patients with Infertility" The Journal of Clinical Endocrinology & Metabolism, Mar. 8, 2000, pp. 2526-2536, vol. 85, No. 7,. p. 2526 only. cited byother.
Tabibzadeh et al., "Temporal and Site-Specific Expression of Transforming Growth Factor-.beta.4 in Human Endometrium" Molecular Human Reproduction, 1998, pp. 595-602, vol. 4, No. 6. p. 595 only. cited by other.
"Radioimmunossay", http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/R/Radioimmunossay.- html, Mar. 2005, pp. 1-3. p. 1 only. cited by other.
Capecchi, M.R., "Altering the Genomome by Homologous Recombination" Science, 1989, pp. 1288-1292, vol. 244, No. 4910. cited by other.
Davies, N.P., et al. "Targeted alterations in yeast artificial chromosomes for inter-species gene transfer" Nucleic Acids Research, 1992, pp. 2693-2698, vol. 20, No. 11. cited by other.
Huxley, C., et al. "The Human HPRT Gene on a Yeast Artificial Chromosome is Functional When Transferred to Mouse Cells by Cell Fusion" Genomics, 1991, pp. 742-750, vol. 9. cited by other.
Jakobovits, A., "Germ-line transmission and expression of a human-derived yeast artificial chromosome" Nature, Mar. 18, 1993, pp. 255-261, vol. 362. cited by other.
Johnson, S. and Bird, R.E., "Construction of Single-Chain Fv Derivatives of Monoclonial Antibodies and Their Production in Escherichia coli" Methods in Enzymology, 1991, pp. 88-99, vol. 203, J.J. Langone ed.; Academic Press, New York, NY. cited byother.
Lamb, B.T., et al., "Introduction and expression of the 400 kilobase precursor amyloid protein gene in transgenic mice" Nature Genetics, Sep. 1993, pp. 22-29, vol. 5. cited by other.
Pearson, B.E. and Choi, T.K., "Expression of the human .beta.-amyloid precursor protein gene from a yeast artificial chromosome in transgenic mice" Proceedings of the National Academy of Sciences USA, Nov. 1993, pp. 10578-10582, vol. 90. cited byother.
Rothstein, R., "Targeting, Distruption, Replacement, and Allele Rescue: Intergative DNA Transformation in Yeast" Methods in Enzymology, 1991, pp. 281-301, vol. 194, Chapter 19, Guide to Yeast Genetics and Molecular Biology, eds. C. Guthrie and G.Fink, Academic Press, Inc. cited by other.
Schedl, A., et al., "A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice" Nature, Mar. 18, 1993, pp. 258-261, vol. 362. cited by other.
Strauss, W.M., et al., "Germ Line Transmission of a Yeast Artificial Chromosome Spanning the Murine a.sub.1(l) Collagen Locus" ScienceMar. 26, 1993, pp. 1904-1907, vol. 259, No. 5103. cited by other.
Gruidl, M., et al., "The progressive rise in the expression of a crystalline B chain in human endometrium is initiated during the implantation window: modulation of gene expression by steroid hormones" Molecular Human Reproduction, 1997, pp.333-342, vol. 3, No. 4. cited by other.
Lessey, B.A. et al., "Integrin Adhesion Molecules in the Human Endometrium, Correlation with the Normal and Abnormal Menstrual Cycle" The Journal of Clinical Investigation, Jul. 1992, pp. 188-195, vo. 90. cited by other.
Kumar, S., et al., "Progresterone Induces Calcitonin Gene Expression in Human Endomentrium within the Putative Window of Implantation" Journal of Clinical Endocrinology and Metabolism, pp. 4443-4450, vol. 83, No. 12. cited by other.
Molloy, S.S., et al., "Bi-cycling the furin pathway: from TGN localization to pathogen activation and embryogenesis" Trends in Cell Biology, Jan. 1999, pp. 28-35, vol. 9. cited by other.
Kothapalli, Ravi et al. "Detection of ebaf, a Novel Human Gene of the Transforming Growth Factor B Superfamily", Journal of Clinical Investigation, May 1997, pp. 2342-2350, vol. 99, No. 10. cited by other.
Wieczorek, Z., et al., "The Immunomodulatory diversity of the proteins of the transforming growth B (TGFB) family" International Journal of Peptide and Protein Research, Jul. 1995, pp. 113-118, vol. 46. p. 113 only. cited by other.
Bowie, James U., et al., "Deciphering the Message in Protein Sequences: Tolerance to amino acid substitution" Science, Mar. 16, 1990, pp. 1306-1310, vol. 247. p. 1306 only. cited by other.
Bassi et al., Accession Nos. AF081508; AF081510, AF081509, Jun. 23, 2006, p. 1. cited by other.
Meno, et al., "Left-right asymmetric of the TFG.beta.--family member lefty in mouse embyros" Nature1996, reference of record, 151-155. p. 151 only. cited by other.
Sporn, M.B., et al., "TFG.beta.: problems and prospects", Cell Regulation, The American Society of Cell Biology, Nov. 1990, pp. 875-882. p. 875 only. cited by other.
Roberts, A.B., et al., "Transforming growth factor .beta.: multifunctional regulator of differentation and development", Phil. Trans. R. Soc. Lond. B, 1990, pp. 145-154, vol. 327, p. 145 only. cited by other.
Burt, David W. et al., Correction: A New Interpretation of a Chicken Transforming Growth Factor--.beta.4 Complementary DNA, Molecular Endocrinology, pp. 989-992, vol. 6, No. 6. p. 989 only. cited by other.
Flanders, Kathleen C., et al., "Antibodies to peptide determinants in Transforming Growth Factor B and their Applications" Biochemistry1988, pp. 739-746, vol. 27. p. 739 only. cited by other.
Postlethwaite, A.E., et al., "Identification of a chemotactic Epitope in Human Transferring Growth Factor-.beta.1 Spanning Amino Acid Residues 368-374", Journal of Cellular Physiology, 1995, pp. 587-592, vol. 164. p. 587 only. cited by other.
Teicher, B.A., et al., "Transforming growth factor--.beta.in vivo resistance", Cancer Chemther Pharmacol1996, pp. 601-609, vol. 37. p. 601 only. cited by other.
Newcom, Samuel, R., et al., "Production of Monoclonal Antibodies That Detect Hodgkin's High Molecular Weight Transforming Growth Factor--.beta." Blood, Jun. 15, 1990, pp. 2434-2437, vol. 75, No. 12. p. 2134 only. cited by other.
Dillner, J., et al., "Antibodies Against a Synthetic Peptide (Gly-Ala)" PNAS, Aug. 1984, pp. 4652-4656, vol. 18. p. 4652 only. cited by other.
Oosterlynck, D.J., et al., "Transforming growth factor B activity is increased in peritoneal fluid from women with endometriosis" Feb. 1994, pp. 287-292, vol. 83, No. 2. p. 287 only. cited by other.
Ayala, A., et al., "The release of transforming growth factor B following hemorrage: its role as a mediator for host immunosuppression" Immunology, 1993, pp. 479-484, vol. 79. p. 479 only. cited by other.
Hoefer, M., et al., Anti (transforming growth factor B) antibodies with predefined specificity inhibit metastasis of highly tumorgenic human xenotransplants in nu/nu mice 1995, pp. 302-308, vol. 41, p. 302 only. cited by other.

Abstract: A method for the early diagnosing of selected adenocarcinomas in a human comprising the steps of removing a bodily sample from the human, and assaying the bodily sample for elevated expression of a specific gene. The gene being assayed for in the bodily sample is the TGFB-4 gene (hereinafter referred to as the endometrial bleeding associated factor (ebaf) gene. The bodily sample can be tissue from a specific organ in the body, or a blood sample. Increased levels of ebaf in the sample relative to basal levels may be indicative of a mucinous adenocarcinoma of the colon or ovaries, or an adenocarcinoma of the testis.
Claim: What is claimed is:

1. An isolated nucleic acid molecule encoding an endometrial bleeding associated factor (ebaf) having the nucleic acid sequence shown in SEQ ID NO. 1.

2. .[.An isolated.]. .Iadd.The isolated .Iaddend.nucleic acid molecule of claim 1 which is a DNA molecule.

3. .[.An isolated.]. .Iadd.The isolated .Iaddend.nucleic acid molecule of claim 1 which is a cDNA molecule.

4. .[.An isolated.]. .Iadd.The isolated .Iaddend.nucleic acid molecule of claim 1 which is an RNA molecule.

.[.5. A 1.5 kb mRNA transcript encoding an isoform of ebaf..].

.[.6. A 2.5 kb mRNA transcript encoding an isoform of ebaf..].

7. .[.An isolated.]. .Iadd.The isolated .Iaddend.nucleic acid molecule of claim 1 which is a probe for detecting the presence of ebaf nucleic acid in bodily samples.
Description: FIELD OFINVENTION

A method for diagnosis of human bodily conditions, and more particularly, a method for diagnosing selected mucinous adenocarcinoma of the colon, or ovaries, or an adenocarcinoma of the testis.

BACKGROUND OF INVENTION

Early diagnosis of particular pathological conditions of the human body can provide patients with adequate time to make well informed decisions regarding the treatment of their pathological condition, as well as prepare for the potentialincapacitation of the patient. One such pathological condition is colon cancer. The American Chemical Society has reported that colon cancer is the second most common cause of cancer in the United States (Fleischer, D. et al. Detection and Survival ofColorectal Cancer (1989) JAMA 261(4):580. It has been estimated that approximately 145,000 new cases of colon cancer are reported yearly in the United States, and the overall mortality rate of this pathological condition is almost 60%. Moreover, adiagnosis of colon cancer has been estimated to shorten that patient's life by six to seven years (Id). Consequently, early detection of this pathological condition offers a patient the best hope of survival.

Approximately three principal screening tests for the early detection of colon cancer or precancerous polyps are presently available to physicians. One such test is the Fecal Occult Blood Test (FOBT). Basically, this test is designed to testwhether blood is present in the fecal material of the patient. Hence, this effectiveness of this test is dependent upon the assumptions that blood in the fecal material is indicative of the presence of colonic neoplasms, and that these neoplasms willbleed in sufficient quantity in order to cause a positive FOBT result.

However, it is because of these necessary assumptions that applicants believe the FOBT contains significant shortcomings as a screening tool for colon cancer. For instance, it has been shown that not all colonic neoplasms bleed sufficiently intothe colon. As a result, this test is readily capable of giving false negative results.

In addition, there are other factors which could result in a false positive result for this test. For example, it has been found that aspirin and other non-inflammatory analgesics have been known to cause irritation in the stomach and increasedgastro-intestinal tract blood loss, thereby producing in a false positive result. The patient's ingestion of rare beef and fruits and vegetables which contain catalases and peroxidases within 24 hours of administering the test may also cause a falsepositive result.

Another screening test that is available is the Carcinoembryonic Antigen (CEA) test. CEA is a glycoprotein that may be produced by cancerous lesions in the colon. This test is designed to measure the concentration of CEA in the patient's bloodto determine if it is elevated relative to normal levels. It is believed that an elevated level is due directly to the presence of colon cancer in the patient. Hence it was hoped CEA would act as a genetic marker for colon cancer. Immunologicaltechniques are usually used to measure CEA levels in the blood.

However, soon after this test became available to health professionals, it was observed that this test was simply too insensitive to recognize numerous types of colon cancers. As a result, the CEA test was relegated to the detection of arecurrence of colon cancer after surgery is performed to remove cancerous lesions from the colon. Even in this role though, it has met with only limited success. In 1993, a study on the effectiveness of CEA testing in 1017 patients was published in theJournal of the American Medical Association. The study showed that 417 patients out of the original group developed recurrent colon cancer, and 247 of these had elevated CEA levels prior to diagnosis of recurrence. However, of the remaining 600patients, 98 also had elevated CEA levels. Hence the rate of false negatives for the test was 41%, and the rate of false-positive results was 16%. (Moertel, C., et al. An Evaluation of the Carcinoembryonic Antigen (CEA) Test for monitoring Patientswith resected Colon Cancer. JAMA 270(8):954 (1993).

In concluding their study, the authors questioned the efficacy of the CEA Test. In support of this conclusion, they explained that, based on their data, the maximum anticipated gain from CEA monitoring would probably be a small number of livessaved (less than 1% of patients monitored) after resection and hepatic metastasis. In addition, the authors specifically stated, "Since the most defensible objective of CEA monitoring is detection of potentially resectable hepatic metastasis, it wouldalso seem appropriate to consider alternative strategies that might fulfill this objective in a more sensitive, specific, and cost-effective manner." (Id)

Another method used to screen for colon cancer is to have the patient undergo a periodic sigmoidoscopic examination. The use of this screening test in a particular patient is dependent upon the age of the patient and whether he or she is amember of a high-risk population. Research on this screening technique has concluded this method to be the best known screening method for colon cancer presently available (see Selby, J. Sigmoidoscopy in the Periodic Health Examination of AsymptomaticAdults JAMA (1989) 261(4): 595)

However, researchers have also acknowledged that this screening method contains inherent limitations. For example, the high cost for the specialized instruments required to perform this screening test, and the special training required in theoperation of the instruments in order to perform the procedure safely are acknowledged. Moreover, general patient discomfort while undergoing this screening is believed to be one of the obstacles in providing mass screening for the general population. Finally, health professionals acknowledge that there is a very slight risk of perforating a patient's colon while undergoing the procedure. Consequently, applicants believe a simple, cost effective screening test for colon cancer is needed.

Another type of pathological condition, present exclusively in women, is ovarian cancer. Ovarian cancer comes from cells of the ovary that grow and divide uncontrollably. Applicants believe that statistical information on ovarian cancerindicates that approximately one woman out of every fifty-five (approximately 1.8%) will develop ovarian cancer some time in her lifetime, and it was believed that in 1996, approximately 26,000 women would be diagnosed with ovarian cancer andapproximately 14,500 women would die of the disease. Moreover, 85 to 90% of women diagnosed with the condition before it spreads from the ovary are cured. However, there is only a 20 to 25% chance of living after diagnosis, if the diagnosis is madeafter the disease has spread beyond the ovary.

Presently, there are methods available to diagnose ovarian cancer, but such methods have inherent limitations. One such method is assaying the patient's blood for elevated levels of Cancer Antigen 125 (CA 125). It has been determined that eightout of ten women with advanced ovarian cancer, and in one out of two women with cancer localized in the ovary will have such elevated levels. However, endometriosis, pelvic inflammatory disease of the tubes and ovaries, uterine fibroids, and pregnancycan also elevate levels of CA 125 in the blood, resulting in false positives.

Another method involves screening the ovaries for a growth, surgically removing the growth, and then performing a biopsy on the growth. Screening can occur with a pelvic examination, during which the physician feels for growths on the ovary, orwith special types of x-rays. If such a growth is discovered, it must be surgically removed, so that a biopsy can be performed. Another such screening method is ultrasound examination of the ovaries. However, like the pelvic examination, this methodprovides no definitive answer regarding the presence of cancer in the ovaries.

Another pathological condition for which early diagnosis would benefit the patient is testicular cancer. With this type of cancer, the patient develops a growth within the body of the testicle. The physician must then determine whether thegrowth is cancerous using presently available diagnostic procedures.

One such procedure is to perform a biopsy on the growth through the scrotum. However, such a procedure presents a problem to the patient in that it could contaminate the scrotum, which could then be a site for the development of cancer. Moreover such a biopsy could disturb the pattern of nodal metastases, and make points for subsequent surgery difficult to predict.

Another such procedure is inguinal orechiectomy, which is done through an incision made above the inguinal ligament. The testicle is then brought up through the inguinal canal and examined visually. However this procedure has limitations inthat it is done surgically, like the biopsy, and is a qualitative inspection of the testes. Consequently, a false positive or false negative can result from this procedure.

Another method available for diagnosing testicular cancer is assaying the patient's blood for elevated levels of Human Chorionic Gonadotrophin, beta subunit (Beta HCG). However, this method contains inherent limitations in that it has beendetermined that low testosterone states, and marijuana use by the patient can produce false positives.

SUMMARY OF THE INVENTION

There is provided, in accordance with the present invention, a method for the early diagnosing of selected adenocarcinomas in a human. Applicants believe that this method is accurate, dependable, inexpensive, and does not possess theshortcomings of the prior art as explained above. In particular, the present invention describes a method for diagnosing an adenocarcinoma in a human comprising the steps of removing a bodily sample from the human, and assaying the bodily sample forelevated expression of a specific gene. The bodily sample can be either tissue from a particular organ, such as the colon or the ovary, or a sample of blood. For purposes of this application, "expression" means either the transcription of the specificgene into at least one mRNA transcript, or the translation of at least one mRNA into a protein.

The specific gene referred to above is the TGFB-4 gene (hereinafter referred to as the endometrial bleeding associated factor (ebaf) gene). Applicants recently discovered this gene in humans (please see Ravi Kothapalli, Ibrahim Buyuksal, Shi-QiWu, Nasser Chegini, Siamak Tabibzadeh: Detection of ebaf, a novel human gene of the TGF-? superfamily; association of gene expression with endometrial bleeding J. Clin. Invest. 1997, 99:2342-2350, which is hereby incorporated by reference herein). ThecDNA sequence of the ebaf gene is set forth in SEQ. ID NO. 1.

Applicants have also discovered that, due to alternative splicing during the transcription of the gene into mRNA, three different mRNA transcripts can result from the transcription of the ebaf gene. One of the transcripts is 1.5 kb in size, oneis 2.1 kb, and the remaining is 2.5 kb. Consequently, such processing will produce three isoforms upon translation of the transcripts. Regardless, elevated expression of the ebaf gene can be determined from elevated levels of any transcript or anyisoform. Hence, one object of the present invention is to provide an accurate, reliable method for the diagnosis and detection of an adenocarcinoma of the testis, or a mucinous adenocarcinoma of the colon in a human male.

Another object of the present invention is to provide an accurate, reliable method for the diagnosis and detection of a mucinous adenocarcinoma of the ovaries, or a mucinous adenocarcinoma of the colon in a human female.

Yet another object of the present invention is to provide a method of diagnosing and detecting a mucinous adenocarcinoma of the ovaries or colon in a female human, or a mucinous adenocarcinoma of the colon or an adenocarcinoma of the testis in ahuman male that is selective for such adenocarcinomas. While the ebaf gene disclosed in the present is expressed in the adenocarcinomas mentioned above, it is not expressed in other types of adenocarcinomas, such as Squamous Cell Carcinoma (SCC),lymphoma or adenocarcinoma. Consequently, the present invention is very selective for the type of adenocarcinomas it is designed to detect. Moreover, in normal tissues, the ebaf gene is expressed only the ovary, pancreas, rectum, endometriumimmediately prior to and during the menstrual cycle, and weakly in the colon and the kidney. Consequently, the number of false positive resulting from the use of the present invention is limited.

Yet still another object of the present invention is to provide a blood test for adenocarcinomas of the testis, and mucinous adenocarcinomas of the colon and ovaries. As stated above, only 6 organs are presently known to express the ebaf geneconstitutively. Applicants believe this constitutive expression results in a basal level of expression of the ebaf gene in the blood. However, if increased levels of expression of the ebaf gene are detected in the blood of a human relative to the basallevel, they indicate the presence of an adenocarcinoma of the testis, or a mucinous adenocarcinoma of the colon or ovary. For example, if increased levels of expression of the ebaf gene are detected in a blood sample from a human male, such levels areindicative of an adenocarcinoma of the testis or a mucinous adenocarcinoma of the colon. If increased levels of expression of the ebaf gene are detected in a sample of blood taken from a female after her period, then such increased levels may beindicative of the presence of a mucinous adenocarcinoma in the colon or ovaries, provided the female does not suffer from abnormal uterine bleeding.

DESCRIPTION OF FIGURES

FIG. 1 is a Northern blot analysis of ebaf mRNA in normal tissues;

FIG. 2 is a Northern blot analysis of ebaf mRNA in colonic adenocarcinomas; and

FIG. 3 is a Northern blot analysis of ebaf mRNA in testicular cancers

DESCRIPTION OF EXAMPLES OF THE INVENTION

In the description of examples of the invention, applicants principally used the Northern Blot method to determine the expression of the ebaf gene in a particular bodily samples made up of tissues from different organs. However, as stated above,any known method capable of detecting whether levels of expression of the ebaf gene in a bodily sample are elevated relative to levels observed in a normal bodily sample of the same type is an acceptable method of practicing the invention. Such assaysinclude, but are not limited to: collecting proteins from a bodily sample and performing an immunoassay on the proteins using monoclonal or polyclonal antibodies raised against the isoforms produced from the expression of the ebaf gene; collecting DNAfrom a bodily sample and performing a southern blot on the DNA using a probe that is complimentary to all or a portion of the ebaf cDNA; collecting RNA from a bodily sample, reverse transcribing the RNA into DNA (RT), amplifying the DNA (via PCR), andthen performing a southern blot on the DNA using a probe that is complimentary to all or a portion of the ebaf cDNA. I. Northern Blotting

The RNA was extracted from samples by using acid guanidinium thiocyanate-phenol-chloroform extraction method as described in Chomczynski, P. and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroformextraction. Anal. Biochem. 1987, 162:156-159 which is hereby incorporated by reference herein. The tissues samples were homogenized in "RNA STAT-60" reagent. Each 50-100 mg of tissue was homogenized in 1 ml of "RNA STAT-60" reagent in a glass orTeflon Dounce homogenizer. Each homogenate was stored for 5 minutes at room temperature to permit the complete dissociation of nucleoprotein complexes. Then, 0.2 ml of chloroform was added for each ml of "RNA STAT-60" reagent used. Each sample wascovered and shaken vigorously for 15 seconds and allowed to stand at room temperature for 2-3 minutes. Following centrifugation at 12,000.times.g for 15 minutes at 4.degree. C., each homogenate was separated into a lower phenol/chloroform phase and anupper aqueous phase. RNA in the upper aqueous phase was transferred to fresh tubes and mixed with isopropoanol to precipitate the total RNA. After centrifugation and drying, the precipitated RNA was dissolved in diethylpyrocarbonate (DEPC)-treatedwater by vigorous pipetting and by a gentle heating at 55-60.degree. C. The amount of RNA in each sample was determined spectro-photometrically and its quality was evaluated by the integrity of ribosomal RNA by electrophoresis of 20 mg of total RNA in1% formaldehyde-agarose gel in the presence of ethidium bromide. Northern blotting was then performed. Briefly, 20 mg of total RNA of each sample was denatured at 65.degree. C. in an RNA loading buffer, electrophoresed in 1% agarose containing 2.2 Mformaldehyde gel, and blotted onto a "HYBOND" nylon membrane using a positive pressure transfer apparatus (Posiblot, Stratagene, La Jolla, Calif.). The RNA was fixed to the membrane by UV cross-linking. Using a "PRIME-A-GENE" kit, cDNA was labeled with[.sup.32P] to a high specific activity, and purified by Nick columns. Membranes were prehybridized in 50% formamide, 10.times.Denhardt's solution, 4% saline sodium citrate (SSC), 0.05 M sodium pyrophosphate and 0.1 mg/ml of denatured Hering sperm DNA at42.degree. C. for 2-4 hr and hybridized for 16 hours at 42.degree. C. with 10.sup.6 cpm/ml of heat-denatured probe in the same buffer containing 10% dextran sulfate. Then, membranes were sequentially washed three times in 4.times.SSC, one time in0.5.times.SSC and then one time in 0.1.times.SSC. All washes contained 0.1% sodium dodecyl sulfate (SDS), and were done at 65.degree. C. for 20 minutes each. The membranes were subjected to autoradiography at -70.degree. C. with intensifying screens. The same blot was stripped and reprobed for GAPDH. To reprobe a blot, the probe was stripped from the membrane in 75% formamide, 0.1.times. saline sodium phosphate ETDA (SSPE), and 0.2% SDS at 50.degree. C. for one hour.

FIG. 1 shows the Northern Blot of ebaf mRNA in normal tissues. In FIG. 1, 20 mg total RNA from each tissue (lane 1: normal menstrual endometrium serving as the positive control and normal tissues (lane 2: spleen, lane 3: lymph node, lanes 4 and5: stomach, lane 6: lung, lane 8: liver, lane 9 and 10: ovary, lane 11: rectum, lane 12: testis, lane 13: pancreas) was subjected to the Northern blot analysis using the entire ebaf cDNA (SEQ. ID No. 1) as the probe. As shown, a band of ebaf mRNA inthe size of 2.5 kilobase (kb) is detected in the endometrium. A weak 2.1 kb ebaf mRNA is detected in the ovary, rectum, and testis. In the pancreas, both the 2.1 and 2.5 kb ebaf mRNA is detected. The ebaf gene was not expressed in the breast, stomach,small bowel, colon, kidney, lung, fallopian tube, spleen and lymph node. Table 1 displays these results in tabular form:

TABLE-US-00001 TABLE 1 Number of Northern blot Tissue tissues examined finding Breast 5 -- Stomach 3 -- Small Bowel 1 -- Colon 11 2.1 kb (weak) Rectum 2 2.1 kb Liver 6 -- Pancreas 2 2.1 and 2.5 kb Kidney 1 2.5 (weak) Lung 1 -- Fallopian Tube 1-- Ovary 7 -- Ovary 1 2.1 kb Testis 2 2.1 kb Spleen 1 -- Lymph node 1 -- --: signal not detected *: of eleven samples tested, only one showed a strong signal. The remaining were not apparent.

The expression of the ebaf gene was then examined in cancers derived from cells of different lineages. In eleven adenocarcinomas of colon, adjacent normal colonic tissues, non-involved by the tumor were available for the study. The RNAs fromthe neoplastic and surrounding normal tissues were both subjected to the Northern blot analysis for the detection of the ebaf mRNA.

Applicants also examined a host of other types of cancer for the expression of the ebaf gene. Using the same Northern Blot procedure stated in each of the previous examples, applicants collected the following data regarding the expression of theebaf gene in non-mucinous adenocarcinomas:

TABLE-US-00002 TABLE 2 Expression of ebaf mRNA in the Non-Mucinous Adenocarcinomas Number of tumors Northern Tumor Type examined blot finding Serous Cystadenocarcinoma of ovary 2 2.1 Serous Cystadenocarcinoma of ovary 2 2.5 SerousCystadenocarcinoma of ovary 5 -- Adenocarcinoma of the colon metastatic to 1 -- ovary Endometroid adenocarcinoma of ovary 1 -- Non-mucinous adenocarcinoma of colon 7 -- Non-mucinous adenocarcinoma of uterine 1 -- cervix Non-mucinous adenocarcinoma of the3 -- stomach Hepatocellular carcinoma 3 -- Renal Cell Carcinoma 3 -- Liver metastasis; Consistent with colonic 6 -- Primary Adenocarcinoma of lung 7 -- Adenocarcinoma of breast 5 -- *: Normal tissues around the tumors were available for the Northern blotanalysis and did not exhibit ebaf mRNA --: Signal not detected

Squamous cell carcinomas and non-epithelial tumors for the expression were also examined for expression of the ebaf gene. The same Northern Blot protocol as explained above was also used for these tumors. The results of these tests are shown inTables 3 and 4, respectively.

TABLE-US-00003 TABLE 3 Expression of ebaf mRNA in Squamous Cell Carcinomas Number of tumors Tumor Type examined Northern blot finding SCC of the Larynx 1 -- SCC of the Lung 4 -- SCC of the Uterine cervix 1 -- --: Signal not detected

TABLE-US-00004 TABLE 4 Expression of ebaf mRNA in Non-epithelial Tumors Number of tumors Northern Tumor Type examined blot finding Leiomyosarcoma, gastric 1 -- Leiomyosarcoma, colon 1 -- Leiomyosarcoma, pelvic 1 -- Chondrosarcoma, thoracic 1 --wall Osteosarcoma, metastatic to 3 -- the lung Liposarcoma, 1 -- retroperitoneum Synovial sarcoma, metastatic 1 -- to the chest wall Synovial sarcoma, parotid 1 -- Synovial sarcoma, Leg Angiosarcoma, mediastinal 1 -- Lymphoma 1 -- Lymphoma, B cell typeLymphoma, B cell, spleen 1 -- Lymphoma, T cell, groin 1 -- Lymphoma, T cell, 1 -- angiocentric, hip Hodgkin's Disease, mixed 1 -- cell type, lymph node Melanoma 5 -- --: signal not detected

EXAMPLE 1

Detection of Mucinous Adenocarcinomas of the Colon

In FIG. 2, 20 mg total RNA from a normal late secretory endometrium which served as the positive control (lane 1) as well as mucinous adenocarcinomas of colon (lanes 2,4,6), non-mucinous adenocarcinomas of colon (lanes 8, 10, and 12) and adjacentnormal colon (lanes 3, 5, 7, 9, 11 and 13) was subjected to the Northern blot analysis using the entire placental-derived ebaf cDNA as the probe (upper panel). Here, the expression of a 2.1 kb ebaf mRNA was detected in seven of the eleven cases ofadenocarcinomas of the colon. The histological evaluation of the positive cases revealed them to have a mucinous differentiation.

EXAMPLE 2

Detection of Adenocarcinomas of the Testis

FIG. 3 is a Northern blot displaying the results of an examination of five cases of testicular cancer for the expression of ebaf gene. 20 mg of total RNA from a normal menstrual endometrium which served as the positive control (lane 1) and eachtumor tissue (lane 2: teratoma-embryonal cell carcinoma, lane 3: mixed germ cell tumor containing embryonal carcinoma, lanes 4-6; seminoma) were subjected to the Northern blot analysis using the entire placental-derived ebaf cDNA as the probe (upperpanel). The blot was exposed for long duration to detect ebaf mRNA in the neoplastic tissues. This resulted in the overexposure of the ebaf mRNAs detected in the endometrium.

The results shown in FIG. 3 indicate that a 2.5 kb ebaf mRNA is detected in the tumors containing embryonal carcinoma. The 2.1 kb mRNA is also detected in two out of three cases of seminoma. The integrity of RNA and equal loading was verifiedby staining the 18S and 28S ribosomal RNAs (not shown) and hybridization of the blots with a cDNA probe to GAPDH (lower panel).

II. RT-PCR of RNA in the Sample Followed by Southern Blotting

Cells in the bodily sample should be lysed in 0.8 ml of "TRIREAGENT" solution (MRC Inc, Cincinnati, Ohio) in the presence of glycogen carrier. Supernatant containing RNA should be combined with 0.2 ml of chloroform, precipitated with isopropanoland washed with 70% ethanol. The RNA pellet should then be dissolved in RNAse-free water and incubated at 37.degree. C. with 40 U DNAse I (Gibco-BRL Life Technologies) for 30 minutes. The reaction would be terminated by the addition of EDTA (20 mM)and incubation for 10 min at 65.degree. C. Total RNA should then be precipitated overnight at -80.degree. C. by the addition of three volumes of absolute ethanol-sodium chloride mixture. The quantity of the RNA would then be determinedspectrophotometrically.

The total RNA would then be reverse transcribed in a 20 ml volume containing 2 mg RNA; 0.2 mg oligo(dT), 1.25 mM of each of dATP, dCTP, dGTP, dTTP; 5 U AMV reverse transcriptase; 10 mM MeHgOH, 88 mM .beta.-mercaptoethanol; 10 U RNAsin; 100 mMTris-HCl (pH 8.3); 40 mM KCl and 10 mM MgCl2. After 60 minutes of incubation at 42.degree. C., the reaction mixture would be heated to 95.degree. C. for 3 minutes. Following addition of 5 U of AMV, the reverse transcription would be carried out foran additional 60 minutes. After a final incubation at 95.degree. C. for 3 minutes, reverse transcription would be terminated by placing the reaction mixture at 0.degree. C.

1 mg of reverse transcribed RNA would then be amplified with 0.5-1 mM of each of the 5' and 3' primers specific for IL-10 in a 50 ml reaction volume containing 1.25 U Ampli-Taq DNA polymerase, 1.25 mM MgCl.sub.2, 20 mM of each of dATP, dCTP,dGTP, dTTP, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and sterile distilled water. Negative control tubes would receive non-reverse transcribed RNA to verify absence of contaminating DNA. Positive control tubes would receive all the reagents in the reactionmixture, however, the primers used would be specific for .beta.-actin. The reaction mixture would be overlayered with 50 ml of mineral oil and the tubes would be heated for 5 minutes at 95.degree. C. After initiation of temperature cycling with aDual-Block Thermal Cycler (Ericomp, San Diego, Calif.), samples would be amplified for 35 cycles. The denaturation temperature would be 95.degree. C. for 1 minute, annealing temperature would be 55.degree. C. for 1 minute and the extension temperaturewould be 72.degree. C. for 2.5 minutes. Temperature cycling would be concluded with a final extension at 72.degree. C. for 10 minutes and the reaction products would be maintained at 4.degree. C. Amplified products will be resolved in a 2% agarosegel and the bands would be visualized by ethidium bromide staining. The fX174 Hae III RF DNA fragments and the 123 basepair DNA ladder will be used as molecular weight markers.

III. Immunoassay

Once antibodies have been raised against the ebaf isoforms, immunoassays can be used to determine whether a bodily sample exhibits increased levels of expression of the ebaf gene. Either polyclonal or monoclonal antibodies can be used in theseassays. The level of expression of the ebaf gene observed from any of these assays should be compared with the basal level of expression the ebaf believed to be in present in healthy samples. If the level of expression is increased relative to thisbasal level, it is indicative to an adenocarcinoma of the testis, or a mucinous adenocarcinoma of the colon or ovaries.

A. Western Blotting

Initially, proteins in the bodily sample are solubilized by adding to the bodily sample an equal volume of 2.times.SDS lysis buffer (6% SDS, 0.14 M Tris, pH 6.8, 22.4% glycerol) and the chromosomal DNA would be sheared by repeatedly passing thesample through a 20-gauge needle and then through a 26-gauge needle. The sample would then be spun at 10,000.times.g for 10 minutes and the amount of protein in the supernatants would be determined using the BCA assay kit (Pierce, Rockford, Ill.). Then, mercaptoethanol (5%) and bromophenol blue (0.5%) would be added and the sample will be boiled for 5 minutes.

Tissue lysates would then be subjected to SDS-PAGE and separated proteins would be transferred to a nitrocellulose or nylon membrane. The membrane would be preblocked by incubation in TBST (10 mM Tris, pH 8.0; 150 mM NaCl; 0.05% Tween-20)containing 3% bovine serum albumin (BSA) at 25.degree. C. for two hours. After washings in TBST (.times.4), the membrane would be stained by avidin-biotin-peroxidase complex (ABC) procedure (Hsu et al, 1981). This would be done by sequentialincubation of the blot, with TBST containing 1% BSA and primary antibody (2-12 hours), and then with secondary antibody (2 hours), and finally ABC (2 hours). Each incubation would be carried at 37.degree. C. and will be followed by two washes in TBST. The immunoreactive band(s) would be revealed by incubation of the blot with a mixture of 3,3' diaminobenzidine tetrahydrochloride (DAB)--H.sub.2O.sub.2. As controls, primary antibody, secondary antibody or ABC would be omitted from the stainingreaction. Primary antibody would be substituted with isotype specific antibody or pre-immune serum at the same protein concentration.

B. Immunohistochemical Staining

Frozen sections will be fixed in 10% buffered formalin for 5 minutes and then washed in 0.1 M PBS. If paraffin sections are used, these will be deparaffinized in xylene and descending series of ethyl alcohol and finally washed in 0.1 M PBS.

Immunostaining would be performed according to the ABC procedure as described in the Western Blot. When paraffin sections are used, if no signal can be detected, sections would be treated prior to immunostaining with pepsin or trypsin asdescribed (Shah et al, 1987a,b). Sections to be viewed at the light microscopic level will be evaluated with and without counterstain.

C. Enzyme Linked Immunosorbent Assay (ELISA)

ELISA is based on antigen-antibody reaction and a subsequent enzyme-mediated color development. The ELISA plates would be made in this laboratory as described in Harlow, E. and Lane, D. Antibodies: A Laboratory Manual. Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y. (1988). If only a monoclonal antibody is available, the antibody capture assay should be used. When both polyclonal and monoclonal antibodies are available the sandwich ELISA for detecting and quantifying theantigen should be used.

Initially, polyclonal antiserum would be raised in rabbits immunized with a bacterially produced chimeric fusion protein or a synthesized peptide of at least one of the isoforms of produced from ebaf gene expression. If required, a secondpeptide would be used to raise a second polyclonal antiserum or monoclonal antibody specific to a different protein domain. Monoclonal antibodies would be synthesized by a commercial vendor (bioWorld, Dublin, Ohio). The positive clones would beidentified by ELISA and then expanded. The specificity of the monoclonal antibodies would be tested against the in vitro expressed proteins.

In the antibody capture assay, known amounts of purified antigen and the bodily sample with an unknown amount of antigen would be bound to the individual wells of a PVC microtitre plate. PVC will bind approximately 100 ng/well (300 ng/cm2). Theplate would be incubated at room temperature for two hours. The plate wold then be washed in PBS and remaining sites on the PVC plate would be saturated overnight in a humid atmosphere at room temperature with a blocking buffer (3% BSA/PBS) containing0.2% sodium azide. After washing the plate twice with PBS, 50 ml of alkaline phosphatase-labeled antibody solution prepared in the same buffer would be added to each well and incubated for two hours at room temperature in a humid atmosphere. Theunbound antibody would be removed by washing the plates four times in PBS.

To ensure that the assay is accurate, the amount of alkaline phosphatase-labeled antibody will be used in excess. The level of secondary antibody needed will be determined by titrating the alkaline phosphatase-labeled antibody. Once standardsare prepared for the detection of known quantities of purified protein, the amount of protein in the samples will be determined using the kit. The amount of unknown protein will be extrapolated from a standard curve based on the known amounts ofprotein.

In the sandwich ELISA, the plates would be coated with the primary monoclonal antibody (20 mg/ml in PBS). After washing the wells with PBS, 50 ml of known amounts of purified antigen and various dilutions of lysate from the bodily sample wouldbe added to the various wells of the plate. After washing, the alkaline phosphatase-labeled antibody to the antigen would be added and the plates re-washed. Each incubation would be for two hours at room temperature. A chemiluminescent detectionsystem (Tropix, Bedfor, Mass.) would be used for detection. This system includes incubation of the plates with an antibody, followed by activation of a substrate (CSPD) that emits light. The amount of light emitted would be directly related to thelevel of expression of the ebaf gene in the sample lysate, and that level would be quantitated by luminometry.

Applicants believe that, any method, either known now or subsequently discovered, which is capable of determining whether the ebaf gene is being expressed in a particular bodily tissue, is an acceptable method to practice the present invention. Hence, many other variations and modifications of the invention will be apparent to those skilled in the art without departing from the spirit and scope of the invention. The above-described embodiments are, therefore, intended to be merely exemplary,and all such variations and modifications are intended to be included within the scope of the invention.

>

SEQUENCE LISTING (RAL INFORMATION: (iii) NUMBER OF SEQUENCES: NFORMATION FOR SEQ ID NO: SEQUENCECHARACTERISTICS: (A) LENGTH: se pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sap iens (vii) IMMEDIATE SOURCE: (A) LIBRARY: genomic(xi) SEQUENCE DESCRIPTION: SEQ ID NO: ACTCTG CCTCCTGCTC CCCCAGGGCA GCACCATGTG GCCCCTGTGG C TCTGCTGGG 6TGGGT GCTGCCCCTG GCTGGCCCCG GGGCGGCCCT GACCGAGGAG C AGCTCCTGG GCCTGCT GCGGCAGCTG CAGCTCAGCG AGGTGCCCGT ACTGGACAGG G CCGACATGG AGCTGGT CATCCCCGCC CACGTGAGGG CCCAGTATGT AGTCCTGCTG C GGCGCGACG 24CGCTC CCGCGGAAAG AGGTTCAGCC AGAGCTTCCG AGAGGTGGCC G GCAGGTTCC 3GTCGGA GGCCAGCACA CACCTGCTGG TGTTCGGCAT GGAGCAGCGG C TGCCGCCCA 36GAGCT GGTGCAGGCC GTGCTGCGGCTCTTCCAGGA GCCGGTTCCC C AAGGCGCGC 42AGGCA CGGGCGGCTG TCCCCGGCAG CGCCCAAGGC CCGGGTGACC G TCGAGTGGC 48CGCGA CGACGGCTCC AACCGCACCT CCCTCATCGA CTCCAGGCTG G TGTCCGTCC 54AGCGG CTGGAAGGCC TTCGACGTGA CCGAGGCCGT GAACTTCTGG C AGCAGCTGA 6GCCCCC GGAGCCGCTG CTCGTACAGG TGTCGGTGCA GAGGGAGCAT C TGGGCCCGC 66TCCGG CGCCCACAAG CTGGTCCGCT TTGCCTCGCA GGGGGCGCCA G CCGGGCTTG 72CCCCA GCTGGAGCTG CACACCCTGG ACCTCAGGGA CTATGGAGCT C AGGGCGACT 78CCTGA AGCACCAATG ACCGAGGGCACCCGCTGCTG CCGCCAGGAG A TGTACATTG 84CAGGG GATGAAGTGG GCCAAGAACT GGGTGCTGGA GCCCCCGGGC T TCCTGGCTT 9GTGTGT GGGCACCTGC CAGCAGCCCC CGGAAGCCCT GGCCTTCAAT T GGCCATTTC 96CCGCG ACAGTGTATC GCCTCGGAGA CTGCCTCGCT GCCCATGATC G TCAGCATCA GAGGGAGG CAGGACCAGG CCCCAGGTGG TCAGCCTGCC CAACATGAGG G TGCAGAAGT AGCTGTGC CTCGGATGGG GCGCTCGTGC CAAGGAGGCT CCAGCATAGG C CCTGGTGTA CATTGAGC CTCTAACTGA ACGTGTGCAT AAGAGGTGGT CTTAATGTAG G GCGTTAACT ATACTTAG CAAGTTACTC CATCCCAATTTAGTGCTCCT GTGTGACCTC G CCCTGTGTC TCCATTCC TGTCTTTCCC GTCCATCACC CATCCTAAGC ACTTACGTGA G TAAATAATG GCTCAGAT GCTGAGCTCT AGTAGGAAAT GCTGGCATGC TGATTACAAG A TACAGCTGA AATGCACA CATTTTCAGC TGGGAGTTTC TGTTCTCTGG CAAATTCTTC A CTGAGTCTG ACAATAAT ACCCTATGAT TAGAACTGGG GAAACAGAAC TGAATTGCTG T GTTATATGA AATTAAAA CCTTCAAATC TCTATTTCCC CCAAATACTG ACCCATTCTG G ACTTTTGTA CATACCTA GGCCCCTGTT CCCCTGAGAG GGTGCTAAGA GGAAGGATGA G GGCTTCAGG GGGGGCAG TGGACAGGGA ATTGGGATACCTGGATTCTG GTTCTGACAG G GCCACAAGC GGATCTCT AACAAACGCA GAAGGCTTTG GCTCGTCATT TCCTCTTAAA A AAGGAGGAG GGGCTTCA GCTCTAAGAA CTTCATTGCC CTGGGGATCA GACAGCCCCT A CCTACCCCT CCACTCCT CTGGAGACTG AGCCTTGCCC GTGCATATTT AGGTCATTTC C CACACTGTC AGAGAACT TGTCACCAGA AACCACATGT ATTTGCATGT TTTTTGTTAA T TTAGCTAAA AATTGAAT GTAGATACTC AGAAGAAATA AAAAATGATG TT R>
* * * * *
 
 
  Recently Added Patents
Mutual charge cancelling sample-reset loop filter for phase locked loops
Containment boom guide system and method
Image processing apparatus and method of same
Joins of relations in an object relational database system
Heat-insulating container and apparatus for producing the same
Grass box discharge rear panel
Mercury oxidation of flue gas using catalytic barrier filters
  Randomly Featured Patents
Anti-tumor agents comprising pyridyl-substituted metal-diphosphine complex
Combined grasping and handling toy rattle or similar article
Heart-shaped brush
Ceramic material and method of making
Insulating adhesive tape, and lead frame and semiconductor device employing the tape
Method for extracting a computer network-based telephone session performed through a computer network
Luminaire
Process for preparing alkyl or aryl phosphorus halides and mixed isomers thereof
Resonant cavity structure for ion laser with floating plate for mirror adjustment
Dynamoelectric machine rotor