Resources Contact Us Home
Browse by: INVENTOR PATENT HOLDER PATENT NUMBER DATE
 
 
Peripheralization of hematopoietic stem cells
RE40811 Peripheralization of hematopoietic stem cells

Patent Drawings:
Inventor: Papayannopoulou
Date Issued: June 30, 2009
Application: 11/635,821
Filed: November 15, 1993
Inventors: Papayannopoulou; Thalia (Seattle, WA)
Assignee: Board of Regents of the University of Washington (Seattle, WA)
Primary Examiner: Ungar; Susan
Assistant Examiner: Goddard; Laura B
Attorney Or Agent: Sterne, Kessler, Goldstein & Fox P.L.L.C.
U.S. Class: 424/130.1; 424/133.1; 424/135.1; 424/143.1; 424/144.1; 424/152.1; 424/153.1; 424/156.1; 424/85.1; 424/85.2
Field Of Search:
International Class: A61K 39/395; A61K 38/19; A61K 38/21
U.S Patent Documents:
Foreign Patent Documents: 0 330 506; 0 455 482; 0 455 482; 0 625 912; 0 626 861; 0 682 529; WO 91/03252; WO 93/13798; WO 93/15764; WO 94/17828
Other References: Williams et al (Nature, Aug. 1991, 352:438-441). cited by examiner.
Issekutz (J of Immunology, Dec. 1991, 147:4178-4184). cited by examiner.
Caux et al (Blood, 1992, 79:2628-2635). cited by examiner.
Teixido et al., "Human CD34 + Progenitor Cell Adhesion to Marrow Stroma is Mediated by VLA-4/VCAM and VLA5/Fibronectin", Blood, 78, Suppl. 1, p. 302a, abstract 1200 (1991). cited by examiner.
Williams et al., "Fibronectin and VLA-4 in hematopoietic Stem Cells-Microenvironment Interactions", Nature, 352, pp. 438-441 (1991). cited by examiner.
Bednarczyk, J.L., et al., "Identification of a Combinatorial Epitope Expressed by the Integrin .alpha.4.beta.1 Heterodimer Involved in the Regulation of Cell Adhesion," J. Biol. Chem. 269:8348-8354, The American Society for Biochemistry andMolecular Biology, Inc. (Mar. 1994). cited by other.
Bensinger, W., et al., "Autologous Transplantation with Peripheral Blood Mononuclear Cells Collected After Administration of Recombinant Granulocyte Stimulating Factor," Blood 81:3158-3163, American Society of Hematology (Jun. 1993). cited by other.
Berenson, R.J., "Transplantation of CD34+ Hematopoietic Precursors: Clinical Rationale," Transplantation Proc. 24:3032-3034, Elsevier Science Inc. (Dec. 1992). cited by other.
Bochner, B.S., et al., "Adhesion of Human Basophils, Eosinophils, and Neutrophils to Interleukin 1-activated Human Vascular Endothelial Cells: Contributions of Endothelial Cell Adhesion Molecules," J. Exp. Med. 173:1553-1556, The RockefellerUniversity Press (Jun. 1991). cited by other.
Bregni,M., et al., "Human Peripheral Blood Hematopoietic Progenitors are Optimal Targets of Retroviral-Mediated Gene Transfer," Blood 80:1418-1422, American Society of Hematology (Sep. 1992). cited by other.
Bronchud, M.H., et al., "In Vitro and In Vivo Analysis of the Effects of Recombinant Human Granulocyte Colony-Stimulating Factor in Patients," Br. J. Cancer 58:64-69, American Society of Hematology (Apr. 1988). cited by other.
Brugger, W., et al., "Ex Vivo Expansion of Enriched Peripheral Blood CD34+ Progenitor Cells by Stem Cell Factor, Interleukin-1.beta. (IL-1.beta.), IL-6, IL-3, Interferon-.gamma., and Erythropoietin," Blood 81:2579-2584, American Society ofHematology (Apr. 1993). cited by other.
Chao, N.J., et al., "Granulocyte Colony-Stimulating Factor `Mobilized` Peripheral Blood Progenitor Cells Accelerate Granulocyte and Platelet Recovery After High-Dose Chemotherapy," Blood 81:2031-2035, American Society of Hematology (Apr. 1993).cited by other.
Craig, J.I., et al., "Peripheral Blood Stem Cell Transplantation," Blood Rev. 6:59-67, Churchill Livingstone (Jun. 1992). cited by other.
DePalma, "CellPro, Inc. Tests Its Stem Cell-Therapy in Clinic Trials," Genet. Eng. News 12, Mary Ann Liebert, Inc. (May 1992). cited by other.
Denkers, I.A., et al., "VLA Molecule Expression May be Involved in the Release of Acute Myeloid Leukaemic Cells from the Bone Marrow," Leukemia Res. 16:469-476, Elsevier Ltd. (May 1992). cited by other.
Edgington, S.M., "New Horizons for Stem-Cell Bioreactors," Biotechnol.10:1099-1106, Nature Publishing Company (Oct. 1992). cited by other.
Elices, M.J., et al., "VCAM-1 on Activated Endothelium Interacts with the Leukocyte Integrin VLA-4 at a Site Distinct from the VLA-4/Fibronectin Binding Site," Cell 60:577-584, Cell Press (1990). cited by other.
European Opposition of EP Patent 0 625 912 document, Declaration of Dr. Roy Lobb, 2 pages (Mar. 13, 1999). cited by other.
European Opposition of EP Patent 0 625 912 , Interlocutory Decision in Opposition Proceedings (Articles 102(3) and 106(3) EPC), 17 pages (Jun. 6, 2001). cited by other.
European Appeal of EP Patent No. 0 625 912, Decision of the Technical Board of Appeal, 29 pages (Oct. 6, 2004). cited by other.
European Opposition of EP Patent No. 0 626 861, Interlocutory Decision in Opposition Proceedings (Articles 102(3) and 106(3) EPC), 17 pages (Feb. 13, 2003). cited by other.
European Appeal of EP Patent No. 0 626 861, Decision of the Technical Board of Appeal, 4 pages (Oct. 23, 2003). cited by other.
European Opposition of EP Patent No. 0 682 529, Interlocutory Decision in Opposition Proceedings (Articles 102(3) and 106(3) EPC), 16 pages (May 28, 2001). cited by other.
Gale, R.P., et al., "Blood Stem Cell Transplants Come of Age," Bone Marrow Transplant. 9:151-155, Nature Publishing Group (Mar. 1992). cited by other.
Gerhartz, H., "Zukunftspersperktiven von Knochenmarkund Stammzellaktivierung fur die autologe Transplantation," Beitr. Infusionther. 28:254-258, Karger (1991). cited by other.
Gillis, "Chap. 21. T-Cell-Derived Lymphokines" in : Fundamental Immunol., Coleman, R.M., ed., McGraw-Hill Professional Publishing, New York, NY, pp. 621-638 (1989). cited by other.
Haas, R., "Successful Autologous transplantation of Blood Stem Cells Mobilized with Recombinant Human Granulocyte-Macrophage Colony-Stimulating Factor," Exp. Hematol. 18:94-98, Elsevier Science Inc. (Feb. 1990). cited by other.
Hemler, M.E., "VLA Proteins in the Integrin Family: Structures, Functions, and Their Role on Leukocytes," Annu. Rev. Immunol.8:365-400, Annual Reviews, Inc. (1990). cited by other.
Kessinger, A. and Armitage, J.O., "The Evolving Role of Autologous Peripheral Stem Cell Transplantation Following High-Dose Therapy for Malignancies," Blood 77:211-213, American Society of Hematology (Jan. 1991). cited by other.
Korbling, M., "Die Tolleder Stammzell-Mobilisation im Rahmen der Autologen Blutstammzell-Transplantation,"Beitr. Infusionther. 28:233-241, Karger (1991). cited by other.
Liesveld, J.L., et al., "Expression of Integrins and Examination of Their Adhesive Function in Normal and Leukemic Hematopoietic Cells," Blood 81:112-121, American Society of Hematology (Jan. 1993). cited by other.
Lobo, F., et al., "Addition of Peripheral Blood Stem Cells Collected Without Mobilization Techniques to Transplanted Autologous Bone Marrow Did Not Hasten Marrow Recovery Following Myeloablative Therapy," Bone Marrow Transplant. 8:389-392, NaturePublishing Group (Nov. 1991). cited by other.
Magrin, et al., "Collection, Processing and Storage of Peripheral Blood Stem Cells (PBSC)," Haematologica, Suppl 1, 76:55-57, Ferrata Storti Foundation (Mar. 1991). cited by other.
Papayannoulou, T. and Nakamoto, B., "Peripheralization of hemopoietic Progenitors in Primates Treated with Anti-VLA4 Integrin," Proc. Natl. Acad. Sci. USA 90L9374-9378, National Academy of Sciences (Oct. 1993). cited by other.
Pulido, R., et al., "Functional Evidence for Three Distinct and Independently Inhibitable Adhesion Activities Mediated by the Human Integrin VLA-4. Correlation with Distinct .alpha.4 Epitopes," J. Biol. Chem. 266:10241-10245, American Society forBiochemistry and Molecular Biology (Jun. 1991). cited by other.
Rowe, J.M. and Rapoport, A.P., "Hemapoietic Growth Factors: A Review," J. Clin. Pharmacol. 32:486-501, Sage Science Press (Jun. 1992). cited by other.
Ryan, D.H., et al., "Inhibition of Human Bone Marrow Lymphoid Progenitor Colonies by Antibodies to VLA Integrins," J. Immunol. 149:3759-3764, American Association of Immunologists (Dec. 1992). cited by other.
Siena, S., et al., Circulation of CD34+ Hematopoietic Stem Cells in the Peripheral Blood of High-Dose Cyclophosphamide-Treated Patients: Enhancement by Intravenous Recombinant Human Granulocyte-Macrophage Colony-Stimulating Factor, Blood74:1905-1914, American Society of Hematology 1989. cited by other.
Simmons, P.J., et al., "Vascular Cell Adhesion Molecule-1 Expressed by Bone Marrow Stromal Cells Mediates the Binding of Hematopoietic Progenitor Cells," Blood 80:388-395, American Society of Hematology (Jul. 1992). cited by other.
Strauch, U.G., et al., "Distinct binding specifities of integrins .alpha.4.beta.7 (LPAM-1) .alpha.4.beta.1 (VLA-4), and IEL.beta.7," Intl. Immunol. 6:263-275, Oxford University Press (Feb. 1994). cited by other.
Teixido, J., et al., "Role of .beta.1 and .beta.2 Integrins in the Adhesion of Human CD34hi Stem Cells to Bone Marrow Stroma," J. Clin. Invest. 90:358-367, American Society for Clinical Investigation (Aug. 1992). cited by other.
U.S. Interference Document, Order--Motion Times--Bd. R. 104(c), Patent Interference No. 105,378, Papayannopoulouv. Masinovsky, 13 pages (Dec. 14, 2005). cited by other.
Teixido, J., et al., "Human CD+Progenitor Cell Adhesion to Marrow Stroma is Mediated by VLA-4/VCAM and VLA5/Fibronectin," Blood Suppl. 1, 78:302a, abstract no. 1200, American Society for Clinical Investigation (Aug. 1992). cited by other.
U.S. Interference Document, Exhibit 2014: Declaration of Timothy A. Springer, Ph.D., submitted by Party Papayannopoulou in Patent Interference No. 105,378 Papayannopoulou v. Masinovsky, 10 pages (Mar. 17, 2006). cited by other.
U.S. Interference Document, Papayannopoulou Substantive Motion 1 and Appendices 1-2, submitted in Patent Interference No. 105,378, Papayannopoulou v. Masinovsky, 38 pages (Mar. 17, 2006). cited by other.
U.S. Interference Document, Redeclaration--Bd.R. 203(c), Patent Interference No. 105,378, Papayannopoulouv. Masinovsky, 4 pages (Aug. 25, 2006). cited by other.
U.S. Interference Document, Papayannopoulou Submission of Transcript of Oral Argument on Aug. 23, 2006, submitted in Patent Interference No. 105,378, Papayannopoulou v. Masinovsky, 88 pages (Oct. 13, 2006). cited by other.
U.S. Interference Document, Decision on Motions, Patent Interference No. 105,378, Papayannopoulouv. Masinovsky, 2 pages (Oct. 20, 2006). cited by other.
U.S. Interference Document, Papayannopoulou Request for Adverse Judgment, submitted in Patent Interference No. 105,378, Papayannopulouv. Masinovsky, 3 pages (Nov. 9, 2006). cited by other.
U.S. Interference Document, Judgment--Request for Adverse --Bd. R. 127(b), Patent Interference No. 105,378, Papayannopoulouv. Masinovsky, 3 pages (Nov. 29, 2006). cited by other.
U.S. Interference Document, Order--Termination of Proceedings--Bd.R. 8, Patent Interference No. 105,378, Papayannoulou v. Masinovsky, 3 pages (Jan. 22, 2007). cited by other.
Weller, P.F., et al., "Human eosinophil adherence to vascular endothelium mediated by binding to vascular cell adhesion molecule 1 and endothelial leukocyte adhesion molecule 1," Proc. Natl. Acad. Sci. USA 88:7430-7433, National Academy of Sciences(Aug. 1991). cited by other.

Abstract: The invention relates to in vivo peripheralization of CD34.sup.+ cells by administering anti-VLA-4 antibodies or anti-VCAM-1 antibodies.
Claim: I claim:

1. A method of peripheralizing CD34.sup.+ cells in vivo comprising the step of administering an anti-VLA-4 antibody .[.or an anti-VCAM-1 antibody.]. which blocks the binding of VLA-4antigen on the surface of the CD34.sup.+ cells to .[.VCAM.]. .Iadd.VCAM-1.Iaddend.or fibronectin.Iadd., and thereby increasing the number of CD34.sup.+ cells in the peripheral blood.Iaddend..

2. The method according to claim 1, wherein the anti-VLA-4 .[.or anti-VCAM-1.]. antibody is a mouse/human.[.,.]. chimeric .Iadd.antibody.Iaddend., single chain .Iadd.antibody.Iaddend., or humanized .Iadd.antibody, .Iaddend.or Fab, Fab',F(ab').sub.2 or F(v) fragments thereof.

3. The method according to claim 1, wherein at least a portion of the CD34.sup.+ cells are hematopoietic stem cells.

4. The method of claim 1, further comprising the step of administering a stimulating agent of CD34.sup.+ cell proliferation in vivo, said stimulating agent being 5-fluorouracil or a cytokine that stimulates hematopoietic cells to.[.proliferated.]. .Iadd.proliferate.Iaddend..

5. The method according to claim 2, further comprising the step of administering a stimulating agent of CD34.sup.+ cell proliferation in vivo, said stimulating agent being 5-fluorouracil or a cytokine that stimulates hematopoietic cells to.[.proliferated.]. .Iadd.proliferate.Iaddend..

6. The method according to claim 3, further comprising the step of administering a stimulating agent of hematopoietic stem cell proliferation in vivo, said stimulating agent being 5-fluorouracil or a cytokine that stimulates hematopoietic cellsto .[.proliferated.]. .Iadd.proliferate.Iaddend..

7. The method according to claim 4, wherein the stimulation is mediated by a cytokine selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), stem cell factor, granulocyte-macrophage colony-stimulating factor(GM-CSF), macrophage colony-stimulating factor (M-CSF), totipotent stem cell factor (T-SCF), stem cell proliferation factor (SCPF), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-6 (IL-6) andinterleukin-11 (IL-11).

8. The method according to claim 5, wherein the stimulation is mediated by a cytokine selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), stem cell factor, granulocyte-macrophage colony-stimulating factor(GM-CSF), macrophage colony-stimulating factor (M-CSF), totipotent stem cell factor (T-SCF), stem cell proliferation factor (SCPF), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-6 (IL-6) andinterleukin-11 (IL-11).

9. The method according to claim 6, wherein the stimulation is mediated by a cytokine selected from the group consisting of granulocyte colony-stimulating factor (G-CSF), stem cell factor, granulocyte-macrophage colony-stimulating factor(GM-CSF), macrophage colony-stimulating factor (M-CSF), totipotent stem cell factor (T-SCF), stem cell proliferation factor (SCPF), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-6 (IL-6) andinterleukin-11 (IL-11).

10. The method according to claim 7, wherein the cytokine is G-CSF.

11. The method according to claim 8, wherein the cytokine is G-CSF.

12. The method according to claim 9, wherein the cytokine is G-CSF.

13. The method according to claim 10, wherein the G-CSF is administered before administering the anti-VLA-4 antibody .[.or anti-VCAM-1 antibody.]. .

14. The method according to claim 11, wherein the G-CSF is administered before administering the anti-VLA-4 antibody .[.or anti-VCAM-1 antibody.]. .
Description: FIELD OF THE INVENTION

The invention relates to the manipulation of hematopoietic stem cells. More particularly, the invention relates to methods for increasing the number of hematopoietic stem cells in peripheral blood.

BACKGROUND OF THE INVENTION

Hematopoietic stem cells are primitive, uncommitted progenitor cells that give rise to the lymphoid, myeloid and erythroid lineages of cells in blood. The stem cell population constitutes only a small proportion of the total cells in bone marrowand represents even a far more minuscule proportion of the cells in peripheral blood.

Stem cells have commonly been characterized by their surface antigenic determinants. Tsukamoto et al., U.S. Pat. No. 5,061,620 (1991), teaches that a highly stem cell concentrated cell composition is CD34.sup.+, CD10.sup.-, CD19.sup.- andCD33.sup.-. Leon et al., Blood 77:1218-1227 (1991), teaches that about one per cent of CD34.sup.+ cells, or about 0.01% of the total marrow cell population, do not express differentiation antigens, such as CD33 (myeloid lineage), CD71 (erythroidlineage) or CD10 and CD5 (lymphoid B and T lineage), and that reduced expression of CD34 expression during maturation is associated with increased expression of the differentiation antigens.

Combinations of antigenic and functional characteristics have also been used to characterize stem cells. Sutherland et al., Proc. Natl. Acad. Sci. U.S.A. 87:3584-3588 (1990), teaches that primitive stem cells do not bind to soybeanagglutinin, express high levels of CD34, form blast colonies with high plating efficiency and are enriched in long-term culture initiating cells (LTC-IC). Craig et al., Blood Reviews 6:59-67 (1992), teaches that the CFU-GM assay is the most widely usedmeasure of the hematopoietic progenitor viability of a bone marrow or peripheral blood stem cell harvest, and correlates well with per cent CD34.sup.+. Spangrude, Immunology Today 10:344-350 (1989), teaches that stem cells accumulate low levels ofrhodamine 123 relative to other bone marrow cell types. Chaudhaury et al., Cell 66:85-94 (1991), teaches that stem cells express high levels of P-glycoprotein relative to other marrow cell types.

The ability to manipulate hematopoietic stem cells has become increasingly important in the development of effective chemotherapeutic and radiotherapeutic approaches to the treatment of cancer. Current approaches to chemotherapy and radiotherapyutilize bone marrow transplantation (BMT). BMT involves removing one to two liters of viable pelvic bone marrow containing stem cells, progenitor cells and more mature blood cells, treating the patient with chemotherapy or radiotherapy to kill tumorcells, and reintroducing bone marrow cells intravenously. BMT, however, suffers from many disadvantages. Harvesting of BM for BMT requires general anaesthesia, which increases both risk and cost. In addition, if cancer cells are present in the marrowand are not rigorously purged, recurrence of the disease is a distinct risk. Also, if widespread invasion of bone marrow by cancer cells (myeloma, Waldenstrom's macroglobulinemia) is present, peripheral blood cells are the only option for use inautologous transplantation (ABMT). Finally, patients who have undergone pelvic irradiation are not candidates for ABMT.

As a result of these difficulties, much interest has been developed in providing methods for obtaining stem cells from peripheral blood for autologous supply of stem cells to patients undergoing chemotherapy. Autologous supply of stem cells fromperipheral blood would allow the use of greater doses of chemo- or radiotherapy, but with less risk than BMT. In addition, the use of stem cells from peripheral blood does not require anaesthesia to obtain the stem cells. Also, Lowry, Exp. Hematol. 20:937-942 (1992), teaches that cancer cells in the marrow tend not to peripheralize. The critical limitation in such a procedure, however, lies in the very small number of stem cells ordinarily present in peripheral blood. Lobo et al., Bone MarrowTransplantation 8:389-392 (1991), teaches that addition of peripheral blood stem cells collected in the absence of any peripheralization techniques does not hasten marrow recovery following myeloablative therapy. In contrast, Haas et al., Exp. Hematol. 18:94-98 (1990), demonstrates successful autologous transplantation of peripheral blood stem cells mobilized with recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF). Thus, increasing the number of stem cells in peripheral bloodby peripheralization techniques is critical to the success of procedures utilizing peripheral blood as a source for autologous stem cell transplantation. Other cytokines may be useful in this regard. Rowe and Rapoport, J. Clin. Pharmacol. 32:486-501(1992), suggests that in addition to GM-CSF, other cytokines, including macrophage colony-stimulating factor (M-CSF), granulocyte colony-stimulating factor (G-CSF), erythropoietin, interleukins-1, -2, -3, -4 and -6, and various interferons and tumornecrosis factors have enormous potential.

Another approach to autologous transplantation is to purify stem cells from peripheral blood using immunoaffinity techniques. These techniques hold promise not only for autologous stem cell transplantation in conjunction with chemotherapy, butalso for gene therapy, in which purified stem cells are necessary for genetic manipulation to correct defective gene function, then reintroduced into the patient to supply the missing function. However, Edgington, Biotechnology 10:1099-1106 (1992),teaches that current procedures require three separate four hour sessions to process enough cells in the absence of peripheralization. DePalma, Genetic Engineering News, Vol. 12, May 1, 1992, teaches that this can be improved by treatment with G-CSF forperipheralization.

These studies underscore the importance of developing new methods to effect the peripheralization of hematopoietic stem cells. One possibility is to search for new ways to release stem cells from the bone marrow environment into the periphery. Unfortunately, little is known about the types of molecular interactions that hold hematopoietic stem cells in the marrow environment in vivo. Recently, some in vitro studies have been undertaken to look at the role of integrins, fibronectin, and othersurface antigens in binding between stem cells and bone marrow stromal cells.

Integrins are a large family of integral membrane glycoproteins having over 16 heterodimeric members that mediate interactions between cells, interactions between cells and the extracellular matrix, and interactions involved in embryonicdevelopment and regulation of T-cell responses. Among integrins, the VLA-5 (.alpha..sup.5.beta..sub.1) complex is widely distributed and functions as a receptor for fibronectin. The VLA-4 (.alpha..sup.4.beta..sub.1) complex is expressed at substantiallevels on normal peripheral blood B and T cells, thymocytes, monocytes, and some melanoma cells an well as on marrow blast cells and erythroblasts. Ligands for VLA-4 are vascular cell adhesion molecule-1(VCAM-1) and CS-1, an alternately spliced domainwithin the Hep II region of fibronectin. Another group of integrins (CDIIa/CD18, CDIIb/CD18, and CDIIc/CD18) share the common .beta..sub.2 chain and are variably expressed on peripheral T cells, monocytes, and mature granulocytes. Ligands for.beta..sub.2-integrins include members of the Ig superfamily (ICAM-1 and ICAM-2) found on activated endothelial cells.

Issekutz, J. Immunol. 147:4178-4184 (1991), discloses that TA-2, a monoclonal antibody to rat VLA-4, inhibits the in vivo migration, of small peritoneal exudate lymphocytes and lymphocytes from peripheral lymph nodes, from the blood across thevascular endothelium to sites of inflammation. This document also observes that systemic treatment of rats with TA-2 was accompanied by an increase in total blood lymphocyte count.

Taixido et al., J. Clin. Invest. 90:358-367 (1992), teaches that in an in vitro model, interactions between VLA-4/VCAM-1, VLA-5/fibronectin and .beta..sub.2-integrin/ICAM-1 are all important for adhesion between bone marrow stromal cells andcells expressing high levels of CD34. Simmons et al., Blood 80:389-395 (1992), teaches that in an in vitro model, adhesion between stromal cells and CD34.sup.- cells was predominantly dependent on the VLA-4/VCAM-1 interaction and was largely inhibitedby monoclonal antibodies to either VLA-4 or VCAM-1, with fibronectin playing a minor role in binding. Williams et al., Nature 352:438-441 (1991), using in vivo mouse studies, teaches that adhesion of murine hematopoietic stem cells to stromal cellextracellular matrix (ECM) is partly promoted by proteolytic fragments of fibronectin containing an alternatively spliced region of the IIICS domain, and suggest that the interaction is likely to be mediated by VLA-4. All of these studies utilizedantibodies to prevent adherence between stem cells and their microenvironment. However, none have analyzed whether such interactions are reversible, or perturbable after adherence has taken place. These results indicate the need for further studies todetermine what interactions between the bone marrow environment and hematopoietic stem cells are responsible for keeping the stem cells within that environment in vivo and whether such interactions can be perturbed to effect peripheralization of stemcells.

There is, therefore, a need for new methods for peripheralizing stem cells, both for scientific investigatory purposes for understanding the processes of peripheralization and homing, and for the development of better methods of peripheralizationfor autologous stem cell transplantation in the course of cancer treatment or gene therapy. Preferably, such methods should produce even higher levels of stem cells in peripheral blood than existing methods provide.

BRIEF SUMMARY OF THE INVENTION

In a first aspect, the invention provides a novel method for increasing the number of hematopoietic stem cells and CD34.sup.+ cells in peripheral blood, which is also known as "peripheralization" or "mobilization" of hematopoietic stem cells andCD34.sup.+ cells. This method comprises the step of administering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells. Various agents can be used to mediate such blocking, including anti-VLA-4 oranti-VCAM-1 antibodies which may optionally be single chain, humanized or chimeric, Fab, Fab', F(ab').sub.2 or F(v) fragments thereof, heavy or light chain monomers or dimers thereof, or intermixtures of the same, soluble fibronectin, CS-1 peptides orfibronectin peptides containing the amino acid sequence EILDV or conservatively substituted amino acid sequences, or soluble VCAM-1, bifunctional VCAM-1/Ig fusion proteins or VCAM-1 peptides.

In another aspect, the invention provides a novel method for peripheralizing hematopoietic stem cells and CD34.sup.+ cells with more predictable greater effectiveness than cytokine treatment alone provides. According to this aspect of theinvention, the method comprises administering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells, as in the first aspect of the invention, in combination with a stimulating agent of hematopoietic stem cellproliferation. The step of administering a stimulating agent of hematopoietic stem cell proliferation can be carried out by using a cytokine, preferably G-CSF, stem cell factor, totipotent stem cell factor, stem cell proliferation factor or GM-CSF, butalternatively M-CSF, erythropoietin, interleukins-1, -2, -3, -4, -6, or 11.

In another aspect, the invention provides an improved method of transplanting peripheral blood stem cells into a patient who has undergone chemotherapy or radiotherapy for cancer. In this method, prior to the administration of myeloablativechemotherapy or radiotherapy, stem cells are peripheralized from the patient's bone marrow by administration of an agent that mediates blocking of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells. This agent may beadministered alone, or preferably in conjunction with an agent that stimulates proliferation of stem cells. The peripheralized stem cells are then collected from peripheral blood by leukapheresis. Stem cells are then enriched from the collectedperipheralized blood by immunoadsorption using anti-CD34 antibodies. Optionally, the enriched stem cells are then expanded ex vivo by culturing them in the presence of agents that stimulate proliferation of stem cells. Following administration ofmyeloablative chemotherapy or radiotherapy, the enriched, and optionally expanded stem cells are then returned to the patient's circulating blood and allowed to engraft themselves into the bone marrow.

In another aspect, the invention provides an improved method of transplanting peripheral blood stem cells into a patient who has undergone myeloablative chemotherapy or radiotherapy for AIDS. This method involves the same steps as described fortransplanting peripheralized stem cells into a patient who has undergone chemotherapy or radiotherapy for cancer. In addition, this method further optionally involves administration to the patient of anti-HIV agents, such as antivirals such as AZT,soluble CD4, and CD4-directed blockers of the AIDS virus or antisense or antigene oligonucleotides, both before and after the return of the enriched and optionally expanded stem cells to the patient's circulating blood. This step serves a "mopping up"function to prevent residual virus from infecting the progeny of the newly returned stem cells.

In another aspect, the invention provides an improved method for carrying out gene therapy in patients having various genetic and acquired diseases. In this method, stem cells are peripheralized from the patient's bone marrow by administrationof an agent that mediates blocking of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells. As in the method previously described herein, this agent may be administered alone or in conjunction with an agent that stimulatesproliferation of stem cells. Peripheral blood is then collected by leukapheresis. Stem cells are then enriched from the collected peripheral blood by immunoadsorption using anti-CD34 antibodies. Optionally, the enriched stem cells are then expanded exvivo by culturing them in the presence of agents that stimulate proliferation of stem cells. The enriched and optionally expanded stem cells are then transduced with an amphotrophic retroviral vector, or other suitable vectors, that expresses a genethat ameliorates the genetic or acquired disease. Optionally, the vector may also carry an expressed selectable marker, in which case successfully transduced cells may be selected for the presence of the selectable marker. The transduced and optionallyselected stem cells are then returned to the patient's circulating blood and allowed to engraft themselves into the bone marrow.

It is an object of the invention to provide a method for peripheralizing hematopoietic stem cells and CD34.sup.+ cells as an experimental model for investigating hematopoiesis, homing of stem cells to the bone marrow, and cytokine-inducedperipheralization of stem cells. It is a further object of the invention to provide a method for optimizing peripheralization of hematopoietic stem cells and CD34.sup.+ cells to provide stem cell-enriched peripheral blood for autologous transplantationfollowing chemo- or radiotherapy. It is a further object of the invention to provide a method for peripheralizing CD34.sup.+ cells to maximize the yield of purified hematopoietic stem cells and progenitor cells from peripheral blood, either forautologous transplantation of the stem cells following chemo- or radiotherapy, or for use in gene therapy. It is a further object of the invention to provide a method for peripheralizing stem cells and CD34.sup.+ cells without risk of causingcytokine-induced cell differentiation of normal stem cells or proliferation of contaminating leukemia cells. It is a further object of the invention to provide a peripheralization technique that has predictable timing for the peak of progenitor contentin peripheral blood for scheduling leukapheresis.

The invention satisfies each of these objects by providing a method for peripheralizing stem cells and CD34.sup.+ cells by administering a blocking agent of VLA-4 antigen on the surface of hematopoietic stem cells. This effect can be increasedby the use of such blocking agents in conjunction with approaches to amplify stem cells to produce a synergistic effect.

BRIEF DESCRIPTION OF THE DRAWINGS

In the following Figures, which further exemplify the claimed invention, dashed lines represent total white blood cell counts, as recorded on the right vertical axes. Black boxes represent BFUe as represented on the left vertical axes. Downwardarrows represent points of administration of antibody. Horizontal axes represent days before and after first administration of antibody.

FIG. 1A is a profile of total white blood cells and CFU in peripheral blood before treatment of macaques.

FIG. 1B is a profile of total white blood cells and CFU in peripheral blood of a baboon after treatment with anti-VLA-4 antibodies.

FIG. 1C is a profile of total white blood cells and CFU in peripheral blood of a macaque after treatment with anti-VLA-4 antibodies.

FIG. 2 is a profile of total white blood cells and CFU in peripheral blood before treatment of an animal with the anti-CD18 monoclonal antibody 60.3. All symbols are as defined above.

FIG. 3A is a profile of the results of combined treatment with G-CSF and anti-VLA-4 monoclonal antibody HP1/2. The symbols are as described above, except that narrow downward-pointing arrows represent points of G-CSF administration, bolddownward-pointing arrows represent points of antibody administration, and dotted line (with triangles) represent total lymphocyte counts.

FIG. 3B is a profile of the results for a control animal treated with GCSF alone.

FIG. 4A shows high proliferative potential (HPP) progenitors (colonies over 0.5 mm in diameter of compact growth) resulting from combined treatment with GCSF and HP1/2 antibody.

FIG. 4B is a profile of HPP progenitors resulting from treatment with GCSF alone. Symbols are as in FIG. 3.

FIGS. 5A and 5B are the nucleotide sequences encoding the variable heavy region of the heavy and light chains of anti-VLA-4 murine monoclonal antibody HP 1/2.

FIG. 6A is a profile of the results of combined treatment with 5-fluorouracil and anti-VLA-4 murine monoclonal antibody HP1/2. Symbols are as described for FIG. 3.

FIG. 6B is a profile of the results of 5-fluorouracil treatment alone.

FIG. 7A is the nucleotide sequences of the .sup.V.sub.H-encoding regions having CDR-encoding sequences from murine HP1/2 transplanted therein (SEQ ID NO:3).

FIG. 7B is the nucleotide sequence of the transplanted .sup.V.sub.K sequence (SEQ ID NO:4).

FIG. 8A is a nucleotide sequences encoding the variable regions of the heavy and light chains of the humanized anti-VLA-4 antibody hHP1/2 encoding the .sup.V.sub.H region (SEQ ID NO:5).

FIG. 8B is the nucleotide sequence encoding the .sup.V.sub.K region (SEQ ID NO:6).

FIG. 9 is a profile of the results of treatment with humanized anti-VLA-4 antibody hHP1/2. Symbols are as described for FIG. 3.

FIG. 10 is a profile of the results of treatment with murine Fab fragments of anti-VLA-4 antibody HP1/2. Symbols are as described for FIG. 3.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The invention relates to the manipulation of hematopoietic stem cells. More particularly, the invention relates to the peripheralization of hematopoietic stem cells and other CD34.sup.+ cells.

In a first aspect, this invention provides a method for peripheralizing hematopoietic stem cells and CD34.sup.+ cells, comprising the step of administering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells andCD34.sup.+ cells. For purposes of this invention, the term "blocking agent of VLA-4 antigens" is intended to mean an agent that is capable of interfering with interactions between VLA-4 antigens and either VCAM-1 or fibronectin on the surface of stromalcells or in the extracellular matrix (ECM). As demonstrated herein, such blocking of VLA-4 antigens causes peripheralization of stem cells and CD34.sup.+ cells. This demonstration utilized a monoclonal antibody against VLA-4 as a blocking agent. Thoseskilled in the art will recognize that, given this demonstration, any agent that can block VLA-4 antigens can be successfully used in the method of this invention. Thus, for purposes of this invention, any agent capable of blocking VLA-4 antigens on thesurface of hematopoietic stem cells is considered to be an equivalent of the monoclonal antibody used in the examples herein. For example, this invention contemplates as equivalents at least peptides, peptide mimetics, carbohydrates and small moleculescapable of blocking VLA-4 antigens on the surface of CD34.sup.+ cells or hematopoietic stem cells.

In a preferred embodiment, the blocking agent that is used in the method of this invention to block VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells is a monoclonal antibody or antibody derivative. Preferredantibody derivatives include humanized antibodies, chimeric antibodies, single chain antibodies, Fab, Fab', F(ab').sub.2 and F(v) antibody fragments, and monomers or dimers of antibody heavy or light chains or intermixtures thereof. The successful useof monoclonal antibody OKT3 to control allograft rejection indicates that, although humanized antibodies are preferable, murine monoclonal antibodies can be effective in therapeutic applications. Monoclonal antibodies against VLA-4 are a preferredblocking agent in the method according to this invention. Human monoclonal antibodies against VLA-4 are another preferred blocking agent in the method according to the invention. These can be prepared using in vitro-primed human splenocytes, asdescribed by Boerner et al., J. Immunol. 147:86-95 (1991). Alternatively, they can be prepared by repertoire cloning as described by Persson et al., Proc. Natl. Acad. Sci. U.S.A. 88:2432-2436 (1991) or by Huang and Stollar, J. of Immunol. Methods141:227-236 (1991). Another preferred blocking agent in the method of the present invention is a chimeric antibody having anti-VLA-4 specificity and a human antibody constant region. These preferred blocking agents can be prepared according toart-recognized techniques, as exemplified in U.S. Pat. No. 4,816,397 and in Morrison et al., Proc. Natl. Acad. Sci. U.S.A. 81:6851-6855 (1984). Yet another preferred blocking agent in the method of this invention is a humanized antibody havinganti-VLA-4 specificity. Humanized antibodies can be prepared according to art-recognized techniques, as exemplified in Jones et al., Nature 321:522 (1986); Riechmann, Nature 332:323 (1988); Queen et al., Proc. Natl. Acad. Sci. U.S.A. 86:10029(1989); and Orlandi et al., Proc. Natl. Acad. Sci. U.S.A. 86:3833 (1989). Those skilled in the art will be able to produce all of these preferred blocking agents, based upon the nucleotide sequence encoding the heavy and light chain variableregions of HP1/2 [SEQ. ID. NOS. 1 and 2], as shown in FIG. 5, using only well known methods of cloning, mutagenesis and expression (for expression of antibodies, see, e.g., Boss et al., U.S. Pat. No. 4,923,805). Two other preferred blocking agentsare single chain antibodies, which can be prepared as described in U.S. Pat. No. 4,946,778, the teachings of which are hereby incorporated by reference; and biosynthetic antibody binding sites, which can be prepared as described in U.S. Pat. No.5,091,513, the teachings of which are hereby incorporated by reference. Those skilled in the art will recognize that any of the above-identified antibody or antibody derivative blocking agents can also act in the method of the present invention bybinding the receptor for VLA-4, thus acting as agents for blocking the VLA-4 antigen on the surface of hematopoietic stem cells, within the meaning of this term for purposes of this invention. Thus, antibody and antibody derivative blocking agentsaccording to this invention, as described above, include embodiments having binding specificity for VCAM-1 or fibronectin, since these molecules appear to either be important in the adhesion between stem cells and stromal cells or the extracellularmatrix or interfere with traffic of stem cells through other tissues and blood.

In another preferred embodiment, the blocking agents used in the method according to this invention are not antibodies or antibody derivatives, but rather are soluble forms of the natural binding proteins for VLA-4. These blocking agents includesoluble VCAM-1, bifunctional VCAM-1/Ig fusion proteins, or VCAM-1 peptides as well as fibronectin, fibronectin having an alternatively spliced non-type III connecting segment and fibronectin peptides containing the amino acid sequence EILDV or a similarconservatively substituted amino acid sequence. These blocking agents will act by competing with the stromal cell- or ECM-bound binding protein for VLA-4 on the surface of stem cells.

In this method according to the first aspect of the present invention, blocking agents are preferably administered parenterally. The blocking agents are preferably administered as a sterile pharmaceutical composition containing apharmaceutically acceptable carrier, which may be any of the numerous well known carriers, such as water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, or combinations thereof. Preferably, the blocking agent, if anantibody or antibody derivative, will be administered at a dose between about 0.1 mg/kg body weight/day and about 10 mg/kg body weight/day. For non-antibody or antibody derivative blocking agents, the dose range should preferably be between molarequivalent amounts to these amounts of antibody. Optimization of dosages can be determined by administration of the blocking agents, followed by CFU-GM assay of peripheral blood, or assay of CD34.sup.+ cells in peripheral blood. The preferred dosageshould produce an increase of at least 10-fold in the CFU-GM counts in peripheral blood.

In a second aspect, the present invention provides a method for peripheralizing hematopoietic stem cells that is far more effective than cytokine treatment alone. According to this aspect of the invention, the method comprises the step ofadministering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells in combination with the step of administering a stimulating agent of hematopoietic stem cell proliferation in vivo. The step of administering a blocking agent ofVLA-4 antigens on the surface of hematopoietic stem cells is carried out in exactly the same fashion that is described for the first apsect of the invention. The step of administering a stimulating agent of hematopoietic stem cell proliferation in vivois preferably carried out through the administration of cytokines.

Preferred cytokines for stimulating hematopoietic stem cells to proliferate include granulocyte colony-stimulating factor (G-CSF), stem cell factor, totipotent stem cell factor (TSCF), stem cell proliferation factor (SCPF), granulocyte-macrophagecolony-stimulating factor (GM-CSF), macrophage colony-stimulating factor (M-CSF), erythropoietin, interleukin-1, -2, -3, -4, -6, and -11. Most preferred are G-CSF, stem cell factor and GM-CSF, because all three of these are known to cause proliferationof stem cells. The ability of G-CSF and GM-CSF to stimulate proliferation of progenitors is well established (see, e.g., Metcalf, Nature 339:27-30 (1989)), as is their ability to cause peripheralization of hematopoietic stem cells (see, e.g., Haas etal., Exp. Hematol. 18:94-98 (1990) and Blood 72:2074 (1988). This ability has also been established for stem cell factor (Andrews et al., Blood 80:920-927 (1992)). In addition, the enormous potential of these other cytokines identified herein hasbeen recognized (see Rowe and Rapoport, J. Clin. Pharmacol. 32:486-501 (1992)). For purposes of this invention, stimulation of hematopoietic stem cells to proliferate can be carried out by any cytokine that is capable of mediating such proliferation invivo. Thus, for purposes of this invention, any cytokine that can stimulate hematopoietic stem cells to proliferate in vivo is considered to be equivalent to G-CSF, stem cell factor and GM-CSF, which are also considered to be equivalent to each other. In addition, the use of chemotherapeutic agents alone can lead to the peripheralization of progenitors. Such agents can also be combined with VLA-4 blocking agents in the method according to the present invention.

In this method according to the second aspect of the invention, cytokines are preferably administered parenterally. The cytokines are preferably administered as a sterile pharmaceutical composition containing a pharmaceutically acceptablecarrier, which may be any of the numerous well known carriers, such as water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, and the like, or combinations thereof. Preferably, the cytokine, if G-CSF, will be administered at a dosebetween about 1 .mu.g/kg body weight/day and about 50 .mu.g/kg body weight/day, most preferably at about 10-15 .mu.g/kg body weight/day. Most preferably, cytokines will be administered over a course of from about four to about ten days. Optimization ofdosages or the combination of cytokines (e.g., G-CSF and kit ligand) can be determined by administration of the cytokine and administration of the blocking agents, followed by CFU-GM assay of peripheral blood. The preferred dosage should produce anincrease of at least 5-fold in the CFU-GM counts per milliliter of peripheral blood, compared with cytokines alone.

According to this aspect of the present invention, the step of administering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells or CD34.sup.+ cells and the step of administering stimulating agents for proliferation ofthese cells can be carried out concomitantly or sequentially. In a preferred embodiment, the steps are carried out sequentially, preferably administering stimulating agents of CD34.sup.+ or hematopoietic stem cell proliferation being the first step.

In a third aspect, this invention provides an improved method of transplanting peripheral blood stem cells into a patient who has undergone chemotherapy or radiotherapy for cancer. In this method, prior to the administration of chemotherapy orradiotherapy, stem cells are peripheralized from the patient's bone marrow by administration of an agent that mediates blocking of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells. The blocking agents used in this methodare preferably selected from those blocking agents described in the discussion of the first aspect of the invention. This agent may be administered alone, or in conjunction with an agent that stimulates proliferation of stem cells. The proliferationstimulating agents optionally used in this method are preferably selected from those proliferation stimulating agents described in the discussion of the second aspect of the invention. The peripheralized stem cells are then collected from peripheralblood by leukapheresis. Stem cells are then enriched from the collected peripheralized blood by CD34 affinity chromatography such as immunoadsorption using anti-CD34 antibodies. Such stem cell enrichment is known in the art and has been described, forexample, by Berenson, Transplantation Proceedings 24:3032-3034 (1992) and the references cited therein. Optionally, the enriched stem cells are then expanded ex vivo by culturing them in the presence of agents that stimulate proliferation of stem cells. This ex vivo expansion can be carried out using, alone or in combination, any of the proliferation stimulating agents described in the discussion of the second aspect of the invention. Such ex vivo expansion of CD34.sup.+ cells from peripheral blood isknown in the art and has been described, for example, by Bruggar et al., Blood 81:2579-2584 (1993). Following administration of chemotherapy or radiotherapy, the enriched and optionally expanded stem cells are then returned to the patient's circulatingblood and allowed to engraft themselves into the bone marrow.

The value of using peripheralized stem cells for transplantation after chemotherapy or radiotherapy for cancer is recognized in the art and has been described in numerous references, including Bensinger et al., Blood 81:3158-3163 (1993); Chao etal., 81:2031-2035 (1993); Kessinger and Armitage, Blood 77:211-213 (1991); Gale et al., Bone Marrow Transplantation 9:151-155 (1992); and Siena et al., Blood 74:1904-1914 (1989). The present method according to the invention provides an improvement inthe transplantation of stem cells from peripheral blood by increasing the concentration of such stem cells in the peripheral blood, thereby greatly improving the likelihood of success of the transplantation.

In a fourth aspect, the present invention provides an improved method of transplanting purified peripheral blood stem cells into a patient who has undergone myeloablative chemotherapy or radiotherapy for AIDS. This method involves the same stepsas described for transplanting peripheralized stem cells into a patient who has undergone chemotherapy or radiotherapy for cancer. In addition, this method further optionally involves administration to the patient of anti-HIV agents, such as antiviralssuch as AZT, soluble CD4, and CD4-directed blockers of the AIDS virus or antisense or antigene oligonucleotides, both before and after the return of the enriched and optionally expanded stem cells to the patient's circulating blood. This step serves a"mopping up" function to prevent residual virus from infecting the progeny of the newly returned stem cells.

The myeloablative chemotherapy or radiotherapy will generally be expected to destroy any cells in the blood that are infected by HIV. The "mopping up" step thus serves to remove any residual virus that otherwise could possibly infect the progenyof the stem cells transplanted into the patient after such therapy. Several agents can be useful in such a "mopping up" step. For example, CD4-directed anti-HIV agents and analogs have been shown to prophylactically prevent infection of uninfectedCD34.sup.+ cells by HIV. Similarly, anti-HIV oligonucleotides have been shown to prevent HIV infection of uninfected cells, for example in U.S. Pat. No. 4,806,463, the teaching of which are hereby incorporated by reference. Such oligonucleotides havebeen shown to prevent virus escape for up to a 100 day test period. See Lisziewicz et al., Proc. Natl. Acad. Sci. U.S.A. 90:3860-3864 (1993). Accordingly, this method according to the invention should provide a new therapeutic approach to AIDS.

In a fifth aspect, this invention provides an improved method for carrying out gene therapy in patients having any of a variety of genetic and acquired diseases. In this method, stem cells are peripheralized from the patient's bone marrow byadministration of an agent that mediates blocking of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells. The blocking agents used in this method are preferably selected from those blocking agents described in the discussionof the first aspect of the invention. As in the method previously described herein, this agent may be administered alone or in conjunction with an agent that stimulates proliferation of stem cells. The proliferation stimulating agent optionally used inthis method is preferably selected from those proliferation stimulating agents described in the discussion of the second aspect of the invention. Peripheral blood is then collected by leukapheresis. Stem cells are then enriched from the collectedperipheral blood by immunoadsorption using anti-CD34 antibodies. Such stem cell enrichment is known in the art and has been described, for example, by Berenson, Transplantation Proceedings 24:3032-3034 (1992) and the references cited therein. Optionally, the enriched stem cells are then expanded ex vivo by culturing them in the presence of agents that stimulate proliferation of stem cells. This ex vivo expansion can be carried out using, alone or in combination, any of the proliferationstimulating agents described in the discussion of the second aspect of the invention. Such ex vivo expansion of CD34.sup.+ cells from peripheral blood is known in the art and has been described, for example, by Bruggar et al., Blood 81:2579-2584 (1993). The enriched and optionally expanded stem cells are then infected with an amphotrophic retroviral vector, or other appropriate vector, that expresses a gene that ameliorates the genetic or acquired disease. Optionally, the vector may also carry anexpressed selectable marker, in which case successfully transduced cells may be selected for the presence of the selectable marker. The transduced and optionally selected stem cells are then returned to the patient's circulating blood and allowed toengraft themselves into the bone marrow. The usefulness of approaches to using stem cells from peripheral blood for retroviral-mediated gene transfer and subsequent transplantation into a patient is recognized in the art and has been described, forexample, by Bragni et al., Blood 80:1418-1422 (1992). The present method according to the invention provides an improvement in the transplantation of stem cells from peripheral blood by increasing the concentration of such stem cells in the peripheralblood, thereby greatly improving the likelihood of success of the retroviral transfection and subsequent transplantation and allows for repeated administration of genetically engineered cells in patients with partially ablative regimens and receivingagents that promote proliferation of transduced cells. Such stem cell enrichment is known in the art and has been described, for example, by Berenson, Transplantation Proceedings 24:3032-3034 (1992) and the references cited therein.

The instant invention is useful for many purposes. The methods of peripheralizing hematopoietic stem cells or CD34.sup.+ cells is of value in scientific research dedicated to understanding the molecular interactions and molecular signalsinvolved in the homing of these cells to bone marrow, as well as their trafficking in response to certain infections and trauma. This invention also provides sources of peripheral blood that is enriched in CD34.sup.+ and hematopoietic stem cells, thusmaking the methods of the invention useful for therapeutic applications involving autologous transplantation of these cell types following chemotherapy or radiotherapy or in the course of gene therapy. The present invention provides many advantages overthe current exclusively cytokine-based techniques. For example, peripheralization can be obtained without risk of cytokine-induced cell differentiation of normal cells or proliferation of contaminating leukemia cells and can be combined with cytotoxicagents. In addition, in the method of the invention, the timing of the peak of progenitors in peripheral blood is consistently between about 24 and about 72 hours from first injection of antibody, thus making the most beneficial timing for leukapheresismore predictable.

The efficacy of specific embodiments of methods according to both aspects of the instant invention is demonstrated in the examples. According to the first aspect of the invention, monoclonal antibodies against VLA-4 were administered to bothmacaques and a baboon. These antibodies, mouse monoclonal HP1/2, have previously been described by Pulido et al., J. Biol. Chem. 266:10241 (1991), and are known to block VLA-4 antigen on various cell surfaces. In the present case, administration ofthese antibodies resulted in as much as a 80-fold increase (average of 40-fold) in CFU-GM present in peripheral blood. The well known CFU-GM assay is the most widely used measure of the hematopoietic progenitor viability of a PBSC harvest and correlateswell with per cent CD34.sup.+ cells present in peripheral blood (see Craig et al., Blood Reviews 6:59-67 (1992)). Thus, these results demonstrate that, in a primate, administering a blocking agent of VLA-4 antigen on the surface of hematopoietic stemcells and CD34.sup.+ cells results in peripheralization of the hematopoietic stem cells and CD34.sup.+ cells. These results should be applicable to humans as well.

According to the second aspect of the invention, monoclonal antibodies against VLA-4 were administered to a macaque after five days of treatment with G-CSF. It is well known that G-CSF can stimulate hematopoietic stem cells and CD34.sup.+ cellsin vivo (see Metcalf, Nature 339:27-30 (1989)). G-CSF alone caused an increase in CFU-GM present in peripheral blood by days 4 and 5 of treatment. After discontinuation of G-CSF treatment and commencement of treatment with anti-VLA-4 antibodies, thenumber of CFU-GM in peripheral blood increased even more dramatically. It will be recognized by those skilled in the art that G-CSF alone does not cause the type of post-treatment increases in CFU-GM that were observed in the present case, as confirmedby a control experiment using G-CSF alone. Thus, these results demonstrate that, in a primate, administering a blocking agent of VLA-4 antigen on the surface of hematopoietic stem cells and CD34.sup.+ cells in combination with administering astimulating agent for proliferation of these cells has a synergistic effect. There is no reason to believe that these results will not apply equally well to humans.

Although not wishing to be bound by theory, Applicant believes that administering a blocking agent of VLA-4 antigens on the surface of hematopoietic stem cells and CD34.sup.+ cells causes peripheralization of these cells by mediating release ofthe cells from the marrow environment via disruption of interactions between VLA-4 and its microenvironmental ligands, such as fibronectin and/or VCAM-1 on stromal cells or in the ECM. Administering stimulating agents of hematopoietic stem cell andCD34.sup.+ cell proliferation is believed to cause peripheralization at least in part via sheer increase in the numbers of these cells. Thus, it is believed that administering a blocking agent of VLA-4 antigens in combination with a stimulating agent ofstem cell proliferation effect peripheralization by complementary mechanisms. The observed synergistic effect between anti-VLA-4 antibodies and G-CSF supports this interpretation. In addition, the observed synergistic effect between anti-VLA-4antibodies and 5-fluorouracil further confirms this interpretation. Since these mechanisms appear to be complementary, the observed synergistic effect should be observed, regardless of whether administration of the blocking agent of VLA-4 antigens andstimulation of proliferation are carried out concomitantly or in sequence.

The following example are intended to further illustrate certain preferred embodiments of the invention and are not intended to be limiting in nature.

EXAMPLE 1

Peripheralization Of Stem Cells Using An Anti-VLA-4 Antibody

Three macaques and one baboon were injected intravenously with anti-VLA-4 mouse monoclonal antibody HP1/2 (1 mg/kg body weight/day) for four consecutive days. At various time points during and after completion of treatment, peripheral blood wascollected and mononuclear cells were collected using a conventional Ficoll-Hypaque separation procedure. Total white blood cells were calculated from the number of mononuclear cells recovered per milliliter of blood. CFU-GM and BFUe were determinedaccording to conventional assays (see, e.g., Papayannopoulou et al., Science 224:617 (1984)). The results of these studies are shown for two macaques (panels A and C) and one baboon (panel B) in FIG. 1. These results demonstrate that treatment of theseprimates with an anti-VLA-4 monoclonal antibody causes a small increase (up to 2-fold) in the total white blood cell count, peaking at about 2 to 4 days after beginning of treatment. More importantly, the total CFU-GM per ml blood increased much moredramatically (about 40-fold), also peaking at about 2 to 4 days after beginning of treatment. In another macaque, a CFU-GM increase of about 8-fold was observed after a single injection of antibody (data not shown). Given the well established use ofthe CFU-GM assay to measure the repopulating potential of hematopoietic progenitors and the correlation between CFU-GM and percentage CD34.sup.+, these results establish that the anti-VLA-4 antibodies cause peripheralization of stem cells.

EXAMPLE 2

Failure of CD18 Blocking Agents to Cause Peripheralization of Stem Cells

The antigen CD18 is present on stem cells and is widely believed to be important in interactions involving stem cells. To test whether blocking agents for CD18 could cause peripheralization of stem cells, another macaque was treated with amonoclonal antibody against CD18. Antibody was delivered by intravenous injection for three days at a dosage of 2 mg/kg of body weight/day. The results of this control experiment are shown in FIG. 2. Total white blood cell counts did increase withthis treatment, consistent with previous experiments with rabbits. However, total GFU-GM showed no increase after treatment with anti-CD18 monoclonal antibodies. Thus, even though CD18 is widely believed to be important in interactions involving stemcells, blocking agents of CD18 do not lead to peripheralization of stem cells or progenitor cells. These results confirm that the peripheralization of stem cells observed upon treatment with anti-VLA-4 monoclonal antibody was indeed due to specificblocking of VLA-4.

EXAMPLE 3

Synergistic Peripheralization Of Stem Cells Resulting From Treatment With Both Anti-VLA-4 Antibody In Combination With G-CSF

A baboon was treated with recombinant human G-CSF twice daily for five consecutive days. Each G-CSF treatment consisted of intravenous injection of 15 micrograms G-CSF per kilogram of body weight. After the five days of G-CSF administration,the baboon received two injections, spaced one day apart, of anti-VLA-4 monoclonal antibody (HP1/2). Each injection contained 1 milligram antibody per kilogram body weight. Total white blood cells and CFU-GM were determined as described in Example 1. The results are shown in FIG. 3. As shown in panel A of that figure, G-CSF resulted in the expected increase in CFU-GM by days 4 and 5 of treatment, along with a marked increase in total white blood cells. Surprisingly, after the administration ofanti-VLA-4 antibody beginning after the last day of a 5 day G-CSF treatment, yet another marked increased in CFU-GM was observed, this time without any increase in total white blood cells. This second increase resulted in about a six-fold improvement inthe number of CFU-GM, relative to G-CSF alone. A control animal treated with G-CSF alone according to the same protocol showed a continuous decline in peripheral blood CFU after cessation of treatment (see FIG. 3, panel B). These results indicate thattreatment with anti-VLA-4 antibody was responsible for this second increase in CFU-GM. Thus, combined treatment with anti-VLA-4 antibody and G-CSF results in a synergistic effect, causing far greater increases in CFU-GM than treatment by either G-CSF oranti-VLA-4 antibodies alone.

EXAMPLE 4

Analysis Of High Proliferative Potential Cells In Peripheral Blood Following Combined Treatment With G-CSF And Anti-VLA-4 Antibody

In the experiments described in Example 3, high proliferative potential (HPP) cells were also counted. HPP cells are cells that give rise to colonies that are macroscopically visible, over 0.5 mm in diameter with dense, compact growth on theanalysis grid. Presence of these cells is associated with greater repopulation capacity and such cells are believed to be earlier progenitors. The results are shown in FIG. 4. The observed disparity in peripheral blood HPP cells between G-CSFtreatment alone and G-CSF treatment in combination with anti-VLA-4 antibodies is even greater than the disparity observed for CFU-GM. These results suggest that the combined treatment not only produces more progenitors, but also produces earlierprogenitors having potentially greater repopulation capacity.

EXAMPLE 5

Synergistic Peripheralization Of Stem Cells Resulting From Treatment With Anti-VLA-4 Antibody In Combination With 5-Fluorouracil

A baboon was treated with the chemotherapeutic agent 5-fluorouracil at a dosage of 100 mg per kilogram body weight. Beginning five days later, the baboon received four injections, spaced one day apart, of anti-VLA-4 monoclonal antibody (HP1/2). Each injection contained one milligram antibody per kilogram body weight. Total white blood cells and CFU-GM were determined as described in Example 1. The results are shown in FIG. 6. As shown in panel B of that figure, 5-fluorouracil alone produceda modest increase in CFU-GM at days 11 and 12. Administration of anti-VLA-4 antibody after the 5-fluorouracil, however, resulted in a dramatic further increase in CFU-GM, an increase of greater than ten times that produced by 5-fluorouracil alone. These results indicate that combined treatment with anti-VLA-4 antibody and 5-fluorouracil produces a synergistic effect, causing far greater increases in CFU-GM than treatment with either agent alone. Moreover, when taken together with theG-CSF/anti-VLA-4 antibody results, these results strongly support the theory that the observed synergism results from stimulation of proliferation of progenitors by one agent and release of the progenitors from the marrow by another. Thus, these resultsstrongly suggest that such a synergistic effect can be produced by any agent that can stimulate proliferation, in conjunction with any agent that can bring about release from the marrow.

EXAMPLE 6

Preparation Of A Humanized Anti-VLA-4 Antibody

The complementarity determining regions (CDRs) of the light and heavy chains of the anti-VLA-4 monoclonal antibody HP1/2 were determined according to the sequence alignment approach of Kabat et al., 1991, 5th Ed., 4 vol., Sequences of Proteins ofImmunological Interest, U.S. Department of Health and Human Services, NIH, U.S.A. The CDRs of murine HP1/2 V.sub.H correspond to the residues identified in the humanized V.sub.H sequences disclosed herein as amino acids 31-35 (CDR1), 50-66 (CDR2) and99-110 (CDR3), which respectively correspond to amino acids 31-35, 50-65 and 95-102 in the Kabat alignment. The CDRs of murine HP1/2 V.sub.K correspond to the residues identified in the humanized V.sub.K sequences disclosed herein as amino acids 24-34(CDR1), 50-56 (CDR2) and 89-97 (CDR3), and to the same residues in the Kabat alignment. The Kabat NEWM framework was chosen to accept the heavy chain CDRs and the Kabat REI framework was chosen to accept the kappa chain CDRs. Transplantation of theCDRs into the human frameworks was achieved by using M13 mutagenesis vectors and synthetic oligonucleotides containing the HP1/2 CDR-encoding sequences flanked by short sequences derived from the frameworks. The V.sub.H mutagenesis vector, M13VHPCR1contains the NEWM framework and has been described by Orlandi et al., Proc. Natl. Acad. Sci U.S.A. 86:3833-3837 (1989). The V.sub.K mutagenesis vector, M13VKPCR2 contains essentially the REI framework and is identical to the M13 VKPCR1 vectordescribed by Orlandi et al., except that there is a single amino acid change from Val to Glu in framework 4. Transplanted product was recovered by PCR and cloned into M13mp19 for sequencing. The transplanted V.sub.H sequence [SEQ. ID NO:3] is shown inFIG. 7, panel A. In addition to the CDR grafting, this product encodes the murine amino acids at positions 27-30 and an Arg to Asp change at position 94. The transplanted V.sub.K sequence [SEQ. ID NO:4] is shown in FIG. 7, panel B.

Additional modifications were introduced via the two step PCR-directed mutagenesis method of Ho et al., Gene 77:51-59 (1989). For the V.sub.H sequence, position 24 (Kabat numbering) was changed from Val to Ala and position 75 (Kabat numbering)was changed from Lys to Ser, then amino acid positions 27-30 and 94 were mutated back to the NEWM sequences. The final humanized V.sub.H sequence [SEQ. ID NO:5] is shown in FIG. 8, panel A. For the V.sub.K sequence, the same two step PCR-directedmutagenesis approach was used to introduce additional modifications. The final humanized V.sub.K sequence [SEQ. ID NO:6] is shown in FIG. 8, panel B.

The entire V.sub.H and V.sub.K regions of humanized HP1/2 were cloned into appropriate expression vectors. The appropriate human IgG1, IgG4or kappa constant region was then added to the vector in appropriate reading frame with respect to themurine variable regions. The vectors were then cotransduced into YB2/0 ray myeloma cells (available from ATCC), which were then selected for the presence of both vectors. ELISA analysis of cell supernatants demonstrated that the humanized antibodyproduced by these cells was at least equipotent with murine HP1/2. The cell line expressing this humanized antibody was deposited with the ATCC on Nov. 3, 1992 and given accession number CRL 11175.

EXAMPLE 7

Peripheralization Of Stem Cells Resulting From Treatment With Humanized Anti-VLA-4 Antibody

Humanized anti-VLA-4 antibodies prepared according to Example 6 were tested for peripheralizing stem cells. The baboon model was used again with three daily antibody injections. The results are shown in FIG. 9. As previously shown for murineantibody, the humanized anti-VLA-4 antibody produces a large increase in peripheralized CFU. Thus, humanized VLA-4 antibodies are capable of causing peripheralization of stem cells and progenitor cells in the same manner as the murine monoclonalantibody HP1/2. This result suggests that the humanized antibody may also be capable, like the monoclonal antibody, of acting synergistically in combination with G-CSF for peripheralizing stem cells.

EXAMPLE 8

Peripheralization Of Stem Cells Resulting From Treatment With Anti-VLA-4 Murine Fab Fragment

Fab fragments from the murine antibody HP1/2 were tested for their ability to peripheralize stem cells and progenitor cells. The experiment was performed by administration of 1 mg/kg of Fab fragment twice daily for three days. In this instance,a modest effect (compared with humanized or monoclonal antibody) was observed, due to the rapid clearance of Fab fragments. Though modest, the observed characteristic BFU-e increase validates this result. This result demonstrates that anti-VLA-4antibody Fab fragments are capable of causing peripheralization of stem cells and progenitor cells. This suggests that anti-VLA-4 Fab fragments may be capable of acting synergistically in combination with G-CSF for peripheralizing stem cells. Inaddition, since the Fab fragments are not known to have any effector function other than binging antigen, this result suggests that any blocking agent that can bind VLA-4 and thereby block its interaction with VCAM-1 will be capable of peripheralizingstem cells, and in doing so, of acting synergistically with factors that promote stem cell proliferation.

>

SEQUENCE LISTING (RAL INFORMATION: (iii) NUMBER OF SEQUENCES: 2 (2) INFORMATION FOR SEQ ID NO: SEQUENCE CHARACTERISTICS: (A) LENGTH: 36pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: AACTGC AGCAGTCTGGGGCAGAGCTT GTGAAGCCAG GGGCCTCAGT C AAGTTGTCC 6AGCTT CTGGCTTCAA CATTAAAGAC ACCTATATGC ACTGGGTGAA G CAGAGGCCT CAGGGCC TGGAGTGGAT TGGAAGGATT GATCCTGCGA GTGGCGATAC T AAATATGAC AAGTTCC AGGTCAAGGC CACTATTACA GCGGACACGT CCTCCAACAC AGCCTGGCTG 24CAGCA GCCTGACATC TGAGGACACT GCCGTCTACT ACTGTGCAGA C GGAATGTGG 3CAACGG GATATGCTCT GGACTTCTGG GGCCAAGGGA CCACGGTCAC C GTCTCCTCA 36NFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3 pairs (B)TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: AGTATTGTGA TGACCCAGAC TCCCAAATTC CTGCTTGTTT CAGCAGGAGA C AGGGTTACC 6CTGCAAGGCCAGTCA GAGTGTGACT AATGATGTAG CTTGGTACCA A CAGAAGCCA CAGTCTC CTAAACTGCT GATATATTAT GCATCCAATC GCTACACTGG A GTCCCTGAT TTCACTG GCAGTGGATA TGGGACGGAT TTCACTTTCA CCATCAGCAC T GTGCAGGCT 24CCTGG CAGTTTATTT CTGTCAGCAG GATTATAGCTCTCCGTACAC G TTCGGAGGG 3
* * * * *
 
 
  Recently Added Patents
Method and program for labeling multi material data
Showerhead with integral valve
Multi-channel binding in data transmission
Method for building a natural language understanding model for a spoken dialog system
Method and apparatus for automated asymmetric digital subscriber line loop testing
Sensor packaging method for a human contact interface
Inverter for driving backlight devices in a large LCD panel
  Randomly Featured Patents
Apparatus for processing synthetic plastics material
Automatic clutter-mapper
Catalytic distillation process
Method for preparing manufacturing plan and method for manufacturing semiconductor products using the manufacturing plan
Room divider screen
Resealable vent valve for containers such as batteries
Method and system for determining pipeline circumferential and non-circumferential wall loss defects in a water pipeline
High-temperature brazed ceramic joints
Instant stain removing device, formulation and absorbent means
Lithium secondary battery and method for manufacturing a negative electrode