| |
 |
Preparation of human IGF via recombinant DNA technology |
| RE39355 |
Preparation of human IGF via recombinant DNA technology
|
|
| Patent Drawings: | |
| Inventor: |
Lee, et al. |
| Date Issued: |
October 17, 2006 |
| Application: |
10/461,712 |
| Filed: |
June 13, 2003 |
| Inventors: |
Lee; James M. (San Bruno, CA) Ullrich; Axel (Munich, DE)
|
| Assignee: |
Genetech, Inc. (South San Francisco, CA) |
| Primary Examiner: |
Allen; Marianne P. |
| Assistant Examiner: |
|
| Attorney Or Agent: |
Hasak; Janet E.Dreger; Ginger R.Heller Ehrman, LLP |
| U.S. Class: |
530/324; 435/69.7; 530/350; 530/399 |
| Field Of Search: |
530/324; 530/350; 530/399; 435/69.7 |
| International Class: |
C07K 14/65 |
| U.S Patent Documents: |
3953418; 4110322; 4342832; 4350764; 4366246; 4387162; 4411994; 4425437; 4431740; 4440859; 4530904; 4543329; 4546082; 4588684; 4652525; 4658021; 4745179; 5015575 |
| Foreign Patent Documents: |
1214739; 022242; 026598; 046039; 055945; 075444; 116201; 121352; 123228; 123289; 123294; 123544; 130166; 135094; 155655; 189481; 56-95199; 57-200343; 8302324; WO 84/03103 |
| Other References: |
"Chiron's elegant, general purpose, rDNA yeast system. A breakthrough?" Biotech News 3(10):1-3 (May 15, 1983). cited by other. "Har "byggdes" Sveriges forsta konstgjorda gen" Svdsvenska Dagbladet (Feb. 1, 1983). cited by other. "Konstgjort arvsanlag framstallt vid Kabi" Goteborgs-Posten (Feb. 3, 1983). cited by other. Achstetter and Wolf, "Hormone processing and membrane-bound proteinases in yeast" The EMBO Journal 4(1):173-177 (1985). cited by other. Alberts, B. Molecular Biology of the Cell, New York and London:Garland Publishing, Inc. pps. 215 (1983). cited by other. Astell et al, "The sequence of DNAs coding for the mating type loci of saccharomyces cerevisiae" Cell 27:15-23 (1981). cited by other. Baum, R.M., "Enzyme chemistry set to advance as new techniques are applied" Chemical and Engineering News pps. 7-14 (Jul. 14, 1986). cited by other. Bell et al., "Nucleotide sequence of a cDNA clone encoding human preproinsulin" Nature 282:525-527 (1979). cited by other. Bell et al., "Sequence of a cDNA clone encoding human preproinsulin-like growth factor II" Nature 310:775-777 (1984). cited by other. Bradshaw and Niall, "Insulin-related growth factors" TIBS 3:274-278 (1978). cited by other. Brake et al, ".alpha.-Factor-directed synthesis and secretion of mature foreign proteins in Saccharomyces cerevisiae" Proc. Natl. Acad. Sci 81:4642-4646 (1984). cited by other. Brake et al., "Identification and Characterization of a Structural Gene for the Yeast Peptide Mating Pheromone, a-factor" J. Cell. Biochem. (abstract 1497) Supp. 7B (Apr. 29, 1983). cited by other. Brousseau et al., "Synthesis of a human insulin gene V. Enzymatic assembly, cloning and characterization of the human proinsulin DNA" Gene 17:279-289 (1982). cited by other. Carpenter, "Epidermal growth factor is a major growth-promoting agent in human milk" Chemical Abstracts (abstract No. 215932m) 93:96 (1980). cited by other. Carpenter and Cohen, "Chapter 5--Epidermal Growth Factors" Biochemical Actions of Hormones (summarized in Chemical Abstracts, vol. 91 (11) 83626m (1979)), Academic Press, Inc. vol. V:203-247 (1978). cited by othe- r. Carpenter et al., "Characterization of the binding of I-labeled epidermal growth factor to human fibroblasts" J. Biol. Chemistry 250(11):4297-4304 (Jun. 10, 1975). cited by other. Casabadan, "Transposition and Fusion of the lac Genes to Selected Promoters in Escherichia coli using Bacteriophage Lambda and Mu" J. Mol. Biol. 104:541-555 (1976). cited by other. Catanzaro et al., "Immunoscreening of Expression Clones Using Antibodies to Renin, EGF and NGF" Manipulation and Expression of Genes in Eukaryotes, Nagley et al. pps. 11-12 (1983). cited by other. Chan et al., "Cell-free synthesis of rat preproinsulins: Characterization and partial amino acid sequence determination" Proc. Natl. Acad. Sci. USA 73(6):1964-1968 (1976). cited by other. City of Hope; Genentech, Inc., "Research Scientists Synthesize Genes to "Command" Laboratory Bacteria to Manufacture Human Insulin" Press Release (Sep. 6, 1978). cited by other. Crea et al., "Chemical synthesis of genes for human insulin"0 Proc. Natl. Acad. Sci. USA 75:5765-5769 (1978). cited by other. Davis and Tai, "The mechanism of protein secretion across membranes" Nature 283:433-438 (1980). cited by other. Dayhoff, "Table of Contents, Preface, Data Section, Protein Data Introduction, Hormones, Active Peptides and Toxins" Atlas of Protein Sequence and Structure, Silver Spring: The National Biomedical Research Foundation vol. 5:vii-xxx, D1-D6, D176,D177, D2 (1972). cited by other. Dayhoff, "Table of Contents, Preface, Protein Data Introduction, Hormones and Active Peptides" Atlas of Protein Sequence and Structure, Silver Spring:The National Biomedical Research Foundation vol. 5(Supp. 3):vii-xxii, 25-28, 145-164 (1978). citedby other. Dayhoff, "Table of Contents, Preface, Protein Data Introduction, Hormones and Active Peptides" Atlas of Protein Sequence and Structure, Washington, DC:National Biomedical Research Foundation vol. 5(Supp. 2):vii-xx, 14, 21-24, 113-145 (1976). citedby other. deHaen et al., "Characterization of Proinsulin-Insulin Intermediates in Human Plasma" J. Clin. Invest. 62:727-737 (1978). cited by other. Dicker et al., "Similarities between fibroblast-derived growth factor and platelet-derived growth factor" Chemical Abstracts (abstract No. 201393r) 95:454 (1981). cited by other. Docherty et al., "Post-translational proteolysis in polypeptide hormone biosynthesis" Annu Rev Physiol 44:625-638 (1982). cited by other. Edge et al., "Total Synthesis of a Human Leukocyte Interferon Gene" Nature 292:756-762 (1981). cited by other. Estell et al., "Engineering an enzyme by site-directed mutagenesis to be resistant to chemical oxidation" J. Biol. Chemistry 260(11):6518-6521 (1985). cited by other. Frank and Chance, "Two Routes for Producing Human Insulin Utilizing Recombinant DNA Technology" Munch. med. Wschr. 125:14-20 (1983). cited by other. Gait, "Synthetic genes for human insulin" Nature 277:429-430 (1979). cited by other. Genentech, Inc., "First Successful Laboratory Production of Human Insulin Announced" Press Release (Sep. 6, 1978). cited by other. Gill et al. Recombinant DNA, Walton, A.G. pps. 213-227 (1981). cited by other. Goeddel et al., "Expression in Escherichia coli of Chemically Synthesized Genes for Human Insulin" Proc. Natl. Acad. Sci. USA 76(1):106-110 (1979). cited by other. Gregory, H., "Isolation and structure of urogastrone and its relationship to epidermal growth factor" Nature 257:325-327 (Sep. 25, 1975). cited by other. Grosjean and Fiers, "Preferential codon usage in prokaryotic genes: the optimal codon-anticodon interaction energy and the selective codon usage in efficiently expressed genes" Gene 18:199-209 (1982). cited by other. Higuchi et al., "A general method for cloning eukaryotic structural gene sequences" Proc. Natl. Acad. Sci. USA 73(9):3146-3150 (1976). cited by other. Hinnen et al., "High expression and secretion of foreign proteins in yeast" Chemical Abstracts (abstract No. 40931k) 102:150 (1985). cited by other. Hitzeman et al., "Expression of a Human Gene for Interferon in Yeast" Nature 293:717-722 (1981). cited by other. Hitzeman et al., "Secretion of human interferons by yeast" Science 219:620-625 (1983). cited by other. Hsiung et al., "Synthesis of human insulin gene. Part I. Development of reversed-phase chromatography in the modified triester method. Its application in the rapid and efficient synthesis of eight deoxyriboligonucleotides fragments constitutinghuman insulin A DNA" Nucl. Acids Res. 6:1371-1385 (1979). cited by other. Hsiung et al., "Synthesis of human insulin gene. Part III. Chemical synthesis of 5'-phosphomonoester group containing deoxyribooligonucleotides by the modified phosphotriester method. Its application . . . seventeen fragments constituting humaninsulin C-chain DNA" Nucl. Acids Res. 8:5753-5765 (1980). cited by other. Humbel, "Insulin-like growth factors I and II" European Journal of Biochemistry 190:445-462 (1990). cited by other. Itakura et al., "Expression in Escherichia coli of a Chemically Synthesized Gene for the Hormone Somatostatin" Science 198:1056-1063 (1977). cited by other. Jansen et al., "Sequence of cDNA encoding human insulin-like growth factor I precursor" Nature 306:609-611 (1984). cited by other. Julius et al., "Isolation of the putative structural gene for the lysine-arginine-cleaving endopeptidase required for processing of yeast prepro- -factor" Cell 37:1075-1089 (1984). cited by other. Kadonaga et al., "The role of the .beta.-lactamase signal sequence in the secretion of proteins by Escherichia coli" Journal of Biological Chemistry 259(4):2149-2154 (1984). cited by other. Kemmler et al., "Studies on the Conversion of Proinsulin to Insulin" Journal of Biological Chemistry 246(22):6786-6791 (1971). cited by other. Keshet et al, "Cloning of bovine growth hormone gene and its expression in bacteria" Nucleic Acids Research 9:19-30 (1981). cited by other. Kurjan et al., "Structure of a yeast pheromone gene (MF.alpha.) : a putative .alpha.-factor precursor contains four tandem copies of mature .alpha.-factor" Cell 30:933-973 (1982). cited by other. Li et al., "Total synthesis of insulin-like growth factor I (somatomedin C)" Proc. Natl. Acad. Sci. USA 80:2216-2220 (1983). cited by other. Lomedico et al., "Preparation of pancreatic mRNA: cell-free translation of an insulin-immunoreactive polypeptide" Nucl. Acids Res. 3(2):381-391 (1976). cited by other. Maniatis et al., "Expression of Eukaryotic Genes" Molecular Cloning: A Laboratory Manual, 1st edition, Cold Spring Harbor:Cold Spring Harbor Laboratory Press pps. 412-413 (1982). cited by other. Maniatis et al., "Preface, Contents, and List of References" Molecular Cloning: A Laboratory Manual, 1st edition, Cold Spring Harbor:Cold Spring Harbor Laboratory Press pps. iii-x; 507-520 (1983). cited by other. Mercereau-Puijalon et al. Expression of Eukaryotic Viral & Cellular Genes, Pettersson et al. pps. 295-303 (1981). cited by other. Mercereau-Puijalon et al., "Synthesis of a Chicken Ovalbumin-like Protein in the Yeast Saccharomyces Cerevisiae" Gene 11:163-167 (1980). cited by other. Merryweather et al. Federation Proceedings (AB#1161) 42(7):1956 (May 1, 1983). cited by other. Miller et al., "Synthesis of Biologically Active Proteins by Recombinant DNA Technology" Drug Development Research 1:435-454 (1981). cited by othe- r. Mizuno and Matsuo, "A novel protease from yeast with specificity towards paired basic residues" Nature 309:558-560 (1984). cited by other. Mullenbach et al. Amer. Soc. Biol. Chemists, 74th Annual Meeting, San Francisco, CA (Poster Jun. 5, 1983). cited by other. Mullenbach et al., "The Chemical Synthesis, Molecular Cloning and Expression in Yeast of Genes Coding for Human Insulin-Like Growth Factors" Federation Proceedings (AB#434) 42(7):1832 (May 1, 1983). cited by other. Narang et al., "Synthesis of the human insulin gene. Part IV. New synthetic deoxyriboligonucleotide adaptors and primter for DNA cloning and sequence analysis" Nucl. Acids Res. Symp Series. 7:377-385 (1980). cited by other. O'Farrell et al., "Regulated Expression by Readthrough Translation from a Plasmid-Encoded beta-Galactosidase" J. Bacteriology 134(2):645-654 (1978). cited by other. Ohsuye et al., "Expression of chemically synthesized .alpha.-neo-endorphin gene fused to E. coli alkaline phosphatase" Nucl. Acids Res. 11(5):1283-1295 (1983). cited by other. Oyer et al., "Studies on Human Proinsulin" Journal of Biological Chemistry 246(5):1375-1386 (1971). cited by other. Polisky et al., "A plasmid cloning vehicle allowing regulated expression of eukaryotic DNA in bacteria" Proc. Natl. Acad. Sci. USA 73:3900-3904 (1976). cited by other. Riggs et al., "Synthesis, Cloning, and Expression of Hormone Genes in Escherichia coli" Recent Prog. in Hormone Res. 16:261-274 (1980). cited by other. Rinderknecht and Humbel, "The amino acid sequence of human insulin-like growth factor I and its structural homology with proinsulin" Journal of Biological Chemistry 253(8):2769-2776 (1978). cited by other. Rinderknecht and Humbel, "Amino-terminal sequences of two polypeptides from human serum with nonsuppressible insulin-like and cell-growth-promoting activities: Evidence for structural homology with insulin B chain" Proc. Natl. Acad. Sci. USA73(12):4379-4381 (1976). cite- d by other. Rinderknecht and Humbel, "Polypeptides with nonsuppressible insulin-like and cell-growth promoting activities in human serum: isolation, chemical characterization, and some biological properties of forms I and II" Proc. Natl. Acad. Sci USA73(3):2365-2369 (1976). cited by other. Rinderknecht et al., "Primary structure of human insulin-like growth factor II" FEBS Letters 89(2):283-286 (1978). cited by other. Roberts, T., "A lac Promoter System for the Overexpression of Prokaryotic and Eukaryotic Genes in E. coli" Promoters: Structure and Function, Rodriguez et al. (eds.). Praeger Scientific pps. 452-461 (1982). cited by other. Rossi et al., "An Alternate Method for Synthesis of Double-stranded DNA Segments" Journal of Biological Chemistry 257(16):9226-9229 (1982). cited by other. Rutter, "Production of "Valuable" Proteins in Alternate Biological Hosts" Recombinant DNA and Genetic Experimentation, Morgan and Whelan, Oxford:Pergamon Press pps. 123-128 (1979). cited by other. Schoenle et al., "Insulin-like growth factor I stimulates growth in hypophysectomized rats" Nature 296:252-253 (1982). cited by other. Server and Shooter, "Nerve Growth Factor" Adv. Protein Chem. 31:339-409 (1977). cited by other. Shine et al., "Expression of cloned .beta.-endorphin gene sequences by Escherichia coli" Nature 285:456-461 (1980). cited by other. Stebbing, "Activity of cloned gene products in animal systems" Miami Winter Symposia 19:445-447 (1982). cited by other. Steiner, "Insulin Today" Diabetes 26:322-340 (1977). cited by other. Steiner et al., "Discussion of Jackson & Blobel: Canine pancreatic signal peptidase" Annals of the NY Acad. Sci. 343(1):403-404 (1980). cited by other. Steiner et al., "Insulin Biosynthesis: Evidence for a Precursor" Science 157:697-700 (1967). cited by other. Steiner et al., "New aspects of insulin biosynthesis" pps. 9-19 (1979). cited by other. Suggs et al., "Use of Synthetic Oligonucleotides as Hybridization Probes: Isolation of Cloned cDNA Sequences for Human .beta..sub.2 Microglobulin" Proc. Natl. Acad. Sci. USA 78(11):6613-6617 (Nov. 1981). cited by other. Sung et al., "Synthesis of the human insulin gene. Part II. Further improvements in the modified phosphotriester method and the synthesis of seventeen deoxyribooligonucleotide fragments constituting human insulin chains B and mini-C DNA" Nucl. AcidsRes. 7:2199-2212 (1979). cited by other. Sures et al., "Nucleotide sequence of human preproinsulin complementary DNA" Science 208:57-59 (1980). cited by other. Tacon et al., "The construction and characterisation of plasmid vectors suitable for the expression of all DNA phases under the control of the E. coli tryptophan promoter" Molecular & General Genetics 177(3):427-438 (1980). cited by other. Talmadge et al., "Eukaryotic Signal Sequence Transports Insulin Antigen in Escherichia Coli" Proc. Natl. Acad. Sci. USA 77(6):3369-3373 (1980). cite- d by other. Taniguchi et al., "Expression of the Human Fibroblast Interferon Gene in Escherichia Coli" Proc. Natl. Acad. Sci. USA 77(9):5230-5233 (1980). cite- d by other. Taniguchi et al., "Structure and expression of a cloned cDNA for human interleukin-2" Nature 302(24):305-309 (1983). cited by other. Taylor et al, "Epidermal Growth Factor" J. Biol. Chemistry 247:5928-5934 (1972). cited by other. Ullrich et al., "A bacterial clone synthesizing proinsulin" Proc. Natl. Acad. Sci. USA 75(8):3727-3731 (1978). cited by other. Ullrich et al., "Rat insulin genes: construction of plasmids containing the coding sequences" Science 196:1313-1319 (1977). cited by other. Valenzuela et al., "Is sequence conservation in interferons due to selection for functional proteins?" Nature 313:698-700 (Feb. 1985). cited by other. Wells and Powers, "In vivo formation and stability of engineered disulfide bonds in subtilisin" J. Biol. Chemistry 261(14):6564-6570 (May 15, 1986). cited by other. Wetzel et al., "Expression in escherichia coli of a chemically synthesized gene for a "mini-C" analog of human proinsulin" Gene 16:63-71 (1981). cit- ed by other. Williams et al., "Cytoplasmic inclusion bodies in escherichia coli producing biosynthetic human insulin proteins" Science 215:687-689 (1982). cited by other. Woods et al., "Isolation of cDNA clones for the human complement protein factor B, a Class III Major Histocompatibility Complex Gene Product." Proc. Natl. Sci. USA 79:5661-5665 (Sep. 1982). cited by other. Wunsch et al., "Studies on Enzymatic Methods for Processing Hybrid Proteins Produced by Recombinant DNA Technology" Hoppe-Seyler's Z. Physiol. Chem. 362:1285-1287 (1981). cited by other. Zapf and Froesch, "Radioimmunological determination of insulinlike growth factors I and II in normal subjects and in patients with growth disorders and extrapancreatic tumor hypoglycemia" Chemical Abstracts (abstract No. 218639y) 95:385 (1981).cited by other. Zapf et al., "Insulin-like growth factors I and II: some biological actions and receptor binding characteristics of two purified constituents of nonsuppressible insulin-like activity of human serum" Chemical Abstracts (abstract No. 140765r) 89:78(1978). cited by other. Bishop, "Scientists Use Bacteria to Produce Insulin in Step Toward Better Care for Diabetics" The Wall Street Journal pps. 14 (Jun. 12, 1978). cite- d by other. Lacy et al., "Method for the Isolation of Intact Islets of Langerhans from the Rat Pancreas" Diabetes 16:35-39 (1967). cited by other. Nichol and Smith, "Amino-Acid Sequence of Human Insulin" Nature 181:483-485 (1960). cited by other. Steiner, "Concluding remarks" Proinsulin, Insulin, C-Peptide, Baba et al., Amsterdam-Oxford:Excerpta Medica pps. 449-452 (1979). cited by other. Ullrich et al., "The structure and expression of the insulin gene" Proinsulin, Insulin, C-Peptide, Baba et al., Amsterdam-Oxford:Excerpta Medica pps. 20-26 (1979). cited by other. Villa-Komaroff et al., "A bacterial clone synthesizing proinsulin" Proc. Natl. Acad. Sci. USA 75(8):3727-3731 (1978). cited by other. Weinstein, "A Generalized Homology Correlation for Various Hormones and Proteins" Experientia 28:1517-1522 (1972). cited by other. Yanaihara et al., "Syntheses of C-peptides and human proinsulin" Diabetes 27:149-160 (1978). cited by other. Horner and Hintz, "Further Comparisons of the [.sup.125I] Somatomedin A and the [.sup.125I] Somatomedin C Radioreceptor Assays of Somatomedin Peptide" J. Clin. Endocrinol. Metab. 48(6):959-963 (1979). cited by other. Horner et al., "Comparison of [.sup.125Y] Somatomedin A and [.sup.125I] Somatomedin C Radioreceptor Assays for Somatomedin Peptide Content in Whole and Acid-Chromatographed Plasma" J. Clin. Endocrinol. Metab. 47(6):1287-1294 (1978). cited by other. Klapper et al., "Sequence Analysis of Somatomedin-C: Confirmation of Identity With Insulin-Like Growth Factor I" Endocrinology 112(6):2215-2217 (1983). cited by other. Svoboda et al., "Purification of Somatomedin-C from Human Plasma: Chemical and Biological Properties, Partial Sequence Analysis, and Relationship to Other Somatomedins" Biochemistry 19:790-797 (1980). cited by other. Chan et al., "Biosynthesis and Periplasmic Segregation of Human Proinsulin in Escherichia coli" Proc. Natl. Acad. Sci. USA 78(9):5401-5405 (1981). cited by other. Protein, Nucleic Acid and Enzyme ISSN 28(14):1480-1499 (Dec. 1983). cited by other. Hammarberg, B. et al., PNAS, 86:4367-4371, 1989. cited by examiner. Hammarberg, B. et al., J. of Biotechnology, 14:423-438, 1990. cited by exa- miner. Rhee, H. J. et al., J. of Biotechnology, 13:293-304, 1990. cited by examin- er. |
|
| Abstract: |
Human insulin-like growth factor is synthesized in recombinant cell culture by host cells transformed with expression vectors bearing DNA encoding human insulin-like growth factor. |
| Claim: |
What is claimed is:
1. A fusion protein comprising the amino acid sequence of mature human IGF-I as shown in FIG. 12 or a natural allelic variant thereof consisting of amino acids residues 20-89of SEQ ID NO: 48 and, at the N-terminus of the mature human IGF-I, a bacterial protein followed by an enzymatic proteolysis site linking the bacterial protein and the mature human IGF-I. |
| Description: |
FIELDOF THE INVENTION
This invention relates to the preparation of human IGF (insulin-like growth factor), in various forms, via recombinant DNA technology. Notably, the present invention provides for the preparation of human IGF as a mature protein product ofexpression, processing, and secretion in a recombinant DNA modified host organism. This invention thus provides for the production, isolation, and use of human IGF, in its various forms, as well as to the associated recombinant DNA technology by whichit is prepared. In addition, the present invention relates to the similar preparation of a related protein, human EGF (Epidermal Growth Factor).
The present invention arises in part from the discovery of a novel system by which human IGF can be prepared by a recombinant host organism in the form of a discrete, mature protein. This is accomplished according to one aspect of the presentinvention by an expression system which permits the expression of the amino acid sequence of human IGF fused with at least a portion of the yeast alpha factor signal sequence, followed by processing of said signal sequence, and secretion of mature humanIGF protein into the medium supporting the host organism. Thus, this novel aspect of the present invention, it is believed for the first time, permits the preparation, isolation, and utilization of human IGF as a discrete, mature protein. The presentinvention, in its broad compass, however, converts the preparation of the amino acid sequence of human IGF in other recombinant systems including bacteria and cell culture and includes, therefore, the expression of human IGF DNA sequences providing notonly mature human IGF but also fusion product derivatives containing the amino acid sequence of IGF as the essential component. All such products have been found to be biologically active, hence useful as intended.
The publications and other materials hereof used to illuminate the background of the invention, and in particular cases, to provide additional details concerning its practice are incorporated herein by this reference and for convenience, arealphabetically and numerically referenced in the following text and respectively grouped in the appended bibliography.
BACKGROUND OF THE INVENTION
A. Human IGF (Insulin-like Growth Factor)
Human IGF has been the subject of a fair amount of intensive study by past workers. A body of literature has been developed related to various aspects of this protein or series of proteins (see references A through L).
Insulin-like growth factors I and II have been isolated from human serum (A). The designation "insulin-like growth factor" or IGF was chosen to express the insulin-like effects and the insulin-like structure of these polypeptides which act asmitogens on a member of cells. The complete amino acid sequences of IGF-I and IGF-II have been determined (D,E). They are both single-chain polypeptides with three disulphide bridges and a sequence identity of 49 and 47 percent respectively, to humaninsulin A and B chains. The connecting peptide or C region is considerably shorter than the one of proinsulin and does not show any significant homology to it. (For a summary of earlier studies on the biological efforts of IGF, see Reference F).
IGF-I and IGF-II are growth promoting polypeptides occurring in human serum and human cerebral spinal fluid. Their structure is homologous to proinsulin. IGF-I seems to be produced by the liver along with a specific IGF-binding protein both ofwhich are under control of growth hormone. Thus, human IGF is considered to be an active growth promoting molecule that mediates the effect of human growth hormone.
It was perceived that the application of recombinant DNA and associated technologies would be a most effective way of providing the requisite large quantities of high quality human IGF for applied use to human beings as a growth factor. The goalwas to produce human IGF either as biologically active fusion protein, or more importantly, as a mature protein, as products of recombinant DNA technology from a host organism. Such materials would exhibit bioactivity admitting of their use clinicallyin the treatment of various growth affected conditions.
B. Recombinant DNA Technology
Recombinant DNA technology has reached the age of some sophistication. Molecular biologists are able to recombine various DNA sequences with some facility, creating new DNA entities capable of producing copious amounts of exogenous proteinproduct in transformed microbes and cell cultures. The general means and methods are in hand for the in vitro ligation of various blunt ended or "sticky" ended fragments of DNA, producing potent expression vehicles useful in transforming particularorganisms, thus directing their efficient synthesis of desired exogenous product. However, on an individual product basis, the pathway remains somewhat tortuous and the science has not advanced to a stage where regular predictions of success can bemade. Indeed, those who potend successful results without the underlying experimental basis, do so with considerable risk of inoperability.
DNA recombination of the essential elements, i.e., an origin of replication, one or more phenotypic selection characteristics, an expression promoter, heterologous gene insert and remainder vector, generally is performed outside the host cell. The resulting recombinant replicable expression vehicle, or plasmid, is introduced into cells by transformation and large quantities of the recombinant vehicle are obtained by growing the transformant. Where the gene is properly inserted with referenceto portion which govern the transcription and translation of the encoded DNA message, the resulting expression vehicle is useful to actually produce the polypeptide sequence for which the inserted gene codes, a process referred to as expression. Theresulting product may be obtained by lysing, if necessary, the host cell, in microbial systems, and recovering the product by appropriate purification from other proteins.
In practice, the use of recombinant DNA technology can express entirely heterologous polypeptides-so-called direct expression-or alternatively may express a heterologous polypeptide fused to a portion of the amino acid sequence of a homologouspolypeptide. In the latter cases, the intended bioactive product is sometimes rendered bioinactive within the fused, homologous/heterologous polypeptide until it is cleaved in an extracellular environment. See reference (M) and (N).
Similarly, the art of cell or tissue cultures for studying genetics and cell physiology is well established. Means and methods are in hand for maintaining permanent cell lines, prepared by successive serial transfers from isolated normal cells. For use in research, such cell lines are maintained on a solid support in liquid medium, or by growth in suspension containing support nutriments. Scale-up for large preparations seems to pose only mechanical problems. For further background, attentionis directed to references (O) and (P).
Likewise, protein biochemistry is a useful, indeed necessary, adjunct in biotechnology. Cells producing the desired protein also produce hundreds of other proteins, endogenous products of the cell's metabolism. These contaminating proteins, aswell as other compounds, if not removed from the desired protein, could prove toxic if administered to an animal or human in the course of therapeutic treatment with desired protein. Hence, the techniques of protein biochemistry come to beat, allowingthe design of separation procedures suitable for the particular system under consideration and providing a homogeneous product safe for intended use. Protein biochemistry also proves the identity of the desired product, characterizing it and ensuringthat the cells have produced it faithfully with no alterations or mutations. This branch of science is also involved in the design of bioassays, stability studies and other procedures necessary to apply before successful clinical studies and marketingcan take place.
SUMMARY OF THE INVENTION
The present invention is based upon the discovery that recombinant DNA technology can be used successfully to produce human IGF and related protein, human EGF, preferably in direct form and in amounts sufficient to initiate and conduct animal andclinical testing as prerequisites to market approval. The products human IGF and EGF are suitable for use in all of their forms as produced according to the present invention, viz. in tie prophylactic or therapeutic treatment of human beings forvarious growth associated conditions of diseases. Accordingly, the present invention, in one important aspect, is directed to methods of treating growth conditions in human subjects using human IGF or human EGF, and suitable pharmaceutical compositionsthereof, prepared in accordance with the methods and means of the present invention.
The present invention further comprises essentially pure, mature human IGF, as a product of expression processing, and secretion in a recombinant host organism. Such human IGF is free from association with N-terminus amino acid sequencederivable from the expression systems that can be employed to prepare the material. Thus, while the present invention is directed to the preparation of polypeptides comprising the amino acid sequence of IGF, a notable aspect of the present inventioninvolves the production of the mature human IGF directly into the medium of the recombinant host organism employed. The present invention is also directed to replicable DNA expression vehicle harboring gene sequences encoding human IGF and human EGF inexpressible form, to microorganism strains or cell cultures transformed with such vehicles and to microbial or cell cultures of such transformants capable of producing amino acid sequences of human IGF and human EGF. In still further aspect, the presentinvention is directed to various processes useful for preparing said gene sequences, DNA expression vehicles, microorganisms and cell cultures and specific embodiments thereof. Still further, this invention is directed to the preparation of fermentationcultures of said microorganisms and cell cultures.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 represents the chemically synthesized DNA strands used in the construction of expression vectors for human IGF (DNA IGF-1 Left Half: 1L (43-mer), SEQ ID NO:14 ; DNA IGF-1 Left Half: 3L (43-mer), SEQ ID NO. 15; DNA IGF-1 Left Half: 2L(46-mer), SEQ ID NO. 16; DNA IGF-1 Left Half: 4L (46-mer), SEQ ID NO. 17, DNA IGF-1 Right Half: 1R (46-mer), SEQ ID NO. 18; DNA IGF-1 Right Half: 3R (46-mer), SEQ ID NO. 19; DNA IGF-1 Right Half: 2R (54-mer), SEQ ID NO. 20; DNA IGF-1 Right Half: 4R(46-mer). SEQ ID NO. 21.
FIG. 2 shows the completed double stranded DNA of FIG. 1 (Protein IGF-1 Left Half: Part 1, SEQ ID NO. 22; DNA IGF-1 Left Half: Part 1, SEQ ID NO. 23; Protein IGF-1 Left Half: Part 2, SEQ ID NO. 24; DNA IGF-1 Left Half: Part 2, SEQ ID NO. 25;Protein IGF-1 Right Half: Part 3, SEQ ID NO. 26; DNA IGF-1 Right Half: Part 3, SEQ ID NO. 27; Protein IGF-1 Right Half: Part 4, SEQ ID NO. 28; DNA IGF-1 Right Half: Part 4, SEQ ID NO. 29).
FIG. 3 show the fragments of DNA of FIG. 2 after restriction by EcoRI and PstI and BamHI (Protein IGF-1 Left Half: Part 1, SEQ ID NO. 30; DNA IGF-1 Left Half: part 1: 1L, SEQ ID NO. 31; DNA IGF-1 Left Half: Part 1: 3L, SEQ ID NO. 32; ProteinIGF-1 Left Half: Part 2, SEQ ID NO. 33; DNA IGF-1 Left Half: Part 2: 2L, SEQ ID NO. 34; DNA IGF-1 Left Half: Part 2: 4L, SEQ ID NO. 35).
FIG. 4 depicts the ligation of parts 1 and 2 of FIG. 3 into PBR322.
FIG. 5 show parts 3 and 4 of IGF-I right half (Protein IGF-1 Right Half: Part 3, SEQ ID NO. 36; DNA IGF-1 Right Half: Part 3, SEQ ID NO. 37; DNA IGF-1 Right Half: Part 3, SEQ ID NO. 38; Protein IGF-1 Right Half: Part 4, SEQ ID NO. 39; DNA IGF-1Right Half: Part 4, SEQ ID NO. 40; DNA IGF-1 Right Half: Part 4, SEQ ID NO. 41).
FIG. 6 depicts the ligation of parts 3 and 4 of FIG. 5 into the vector of FIG. 4.
FIG. 7 shows a sequence of DNA (SEQ ID NO. 43) and deduced fusion protein containing IGF-I (SEQ ID NO. 42).
FIG. 8 shows a sequence of DNA (SEQ ID NO. 45) and deduced short fusion protein containing IGF-I (sLE-IGF-1 Fusion Protein, SEQ ID NO. 44).
FIG. 9 depicts a plasmid used in the present construction.
FIG. 10 shows the DNA and protein sequence of IGF-I fused with alpha factor pre-pro sequence (IGF-1 Protein fused with alpha factor pre-pro sequence, SEQ ID NO. 46; DNA, SEQ ID NO. 47).
FIG. 11 is a vector containing alpha factor promotor and pre-pro sequence fused to IGF-I.
FIG. 12 shows the yeast invertase signal fused to IGF-I (Yeast Invertase Signal-IGF-1 fusion protein, SEQ ID NO. 48; DNA, SEQ ID NO. 49). The amino acid sequence of mature human IGF-I is shown in the figure by the underscored amino acids (aminoacids 20-89 of SEQ ID NO. 48).
FIG. 13 shows the parental plasmid containing the yeast PGK promoter.
FIG. 14 depicts a yeast expression vector containing PGK promoter, invertase signal and human IGF-I gene.
FIG. 15 is the synthetic DNA used to construct the coding sequence of mature human EGF (SEQ ID NO. 50).
FIG. 16 depicts the yeast alpha factor "pre-pro" sequence fused to the human EGF coding sequence (Yeast alpha factor protein "pre-pro" sequence fused with EGF, SEQ ID NO. 51; EGF DNA fused with yeast alpha factor "pre-pro" sequence, SEQ ID NO.52).
FIG. 17 depicts the yeast invertase signal sequence fused to the human EGF coding sequence (Yeast invertase signal protein sequence fused with EGF, SEQ ID NO. 53; EGF DNA fused with invertase sequence, SEQ ID NO. 54).
FIG. 18 shows the coding sequence for human IGF-II (Protein coding sequence for Human IGF-II, SEQ ID NO. 55; DNA coding sequence for Human IGF-II, SEQ ID NO. 56).
FIG. 19 illustrates the structure of pools of synthetic oligonucleotides used as hybridization probes to isolate the gene for .alpha.-factor (Protein carboxy terminus of alpha factor, SEQ ID NO. 57; DNA consensus oligonucleotides encodingalpha-factor carboxy terminus, SEQ ID NO. 58; DNA oligonucleotide pool I (complementary to SEQ ID 58), SEQ ID NO. 59; DNA oligonucleotide pool II (complementary to SEQ ID 58), SEQ ID NO. 60).
FIGS. 20A and 20B illustrate the results of electrophoresis of DNA fragments obtained using the probes of FIG. 19.
FIGS . 21A (DNA sequence of alpha factor, SEQ ID NO. 61; Protein sequence of alpha factor, SEQ ID NO. 62) and FIG. 21B (Protein sequence of alpha factor, SEQ ID NO. 63; DNA sequence of alpha factor, SEQ ID NO. 64) and FIG. 22 (DNA sequence ofalpha factor, SEQ ID NO. 65; Protein sequence of alpha factor, SEQ ID NO. 66) are the nucleotide sequences of .alpha.-factor genes.
FIGS. 23A and 23B illustrates the scheme for joining the gene for human interferon D with the gene for the .alpha.-factor promoter and signal sequence.
FIG. 24 illustrate the scheme for construction of a yeast/E. coli shuttle vector for use as a starting plasmid herein for expression of heterologous genes supplying the .alpha.-factor promoter and signal polypeptide gene sequences.
DETAILED DESCRIPTION
A. Definitions
As used herein, "human IGF" and "human EGF" denotes human insulin-like growth factor and human epidermal growth factor, produced by microbial or cell culture systems and bioactive forms comprising the amino acid sequence corresponding to humanIGF and human EGF otherwise native to human tissue. The human IGF and EGF proteins produced herein have been defined by means of DNA, gene, and deductive amino acid sequencing. It will be understood that inasmuch as natural allelic variations exist andoccur from individual to individual, as demonstrated by (an) amino acid difference(s) in the overall sequence or by deletions, substitutions, insertions, inversions, or additions of one or more amino acids of said sequences, the present invention isintended to embrace all of such allelic variations of the two molecules involved. In addition, the location of and the degree of glycosylation depend upon the nature of the recombinant host organism employed and such variations as may occur as includedwithin the ambit of this invention. Finally, the potential exists in the use of DNA technology for the preparation of various derivatives of human IGF and human EGF by simple modification of the underlying gene sequence for such molecules. Suchmodifications could be accomplished by means of site directed mutagenesis of the underlying DNA, as an example. All such modifications resulting in derivatives of human IGF and human EGF are included within the scope of the present invention so long asthe essential characteristic human IGF and human EGF activities remain unaffected in kind.
"Essentially pure form" when used to describe the state of human IGF or human EGF produced by this invention means that the proteins are free of proteins or other materials normally associated with human IGF or human EGF when produced bynon-recombinant cells, i.e. in their "native" environments.
"Expression vector" includes vectors which are capable of expressing DNA sequences contained therein, where such sequences are operably linked to other sequences capable of effecting their expression, i.e., promotor/operator sequences. In sum,"expression vector" is given a functional definition: any DNA sequence which is capable of effecting expression of a specified DNA code disposed therein. In general, expression vectors of utility in recombinant DNA techniques are often in the form of"plasmids" which refer to circular double stranded DNA loops which in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form ofvector. However, the invention is intended to include such other forms of expression vectors which function equivalently and which become known in the art subsequently.
"Recombinant host cells" refers to cells which have been transformed with such vectors. Thus, the human IGF and human EGF molecules produced by such cells can be referred to as "recombinant human IGF" and "recombinant human EGF".
B. Host Cell Cultures and Vectors
The vectors and methods disclosed herein are suitable for use in host cells over a wide range of prokaryotic and eukaryotic organisms.
In general, or course, prokaryotes are preferred for cloning of DNA sequences in constructing the vectors useful in the invention. For example, E. coli K12 strain 294 (ATCC No. 31446) is particularly useful. Other microbial strains which may beused include E. coli strains such as E. coli B, and E. coli X1776 (ATTC No. 31537). The aforementioned strains, as well as E. coli W3110 (F.sup.-, .lamda..sup.-, prototrophic, ATTC No. 27325), bacilli such as Bacillus subtilus, and otherenterobacteriaceae such as Salmonella typhimurium or Serratia marcesans, and various pseudomonas species may be used. These examples are, of course, intended to be illustrative rather than limiting.
In general, plasmid vectors containing replicon and control sequences which are derived from species compatible with the host cell are used in connection with these hosts. The vector ordinarily carries a replication site, as well as markingsequences which are capable of providing phenotypic selection is transformed cells. For example, E. coli is typically transformed using pBR 322, a plasmid derived from an E. coli species (Bolivar, et al., Gene 2: 95 (1977)).pBR322 contains genes forampicillin and tetracycline resistance and thus provides easy means for identifying transformed cells. The pBR322 plasmid, or other microbial plasmid must also contain, or be modified to contain, promoters which can be used by the microbial organism forexpression of its own proteins. Those promoters most commonly used in recombinant DNA construction include the .beta.-lactamase (penicillinase) and lactose promoter systems (Chang et al, Nature, 275: 615(1978), Itakura, et al, Science, 198: 1056 (1977);(Goeddel, et al Nature 281: 544 (1979) and a tryptophan (trp) promoter system (Goeddel, et al, Nucleic Acids Res., 8: 4057 (1980); EPO Appl Publ No. 0036776). While these are the most commonly used, other microbial promoters have been discovered andutilized, and details concerning their nucleotide sequences have been published, enabling a skilled worker to ligate them functionally with plasmid vectors (Siebenlist, et al, Cell 20: 269 (1980)).
In addition to prokaryotes, eukaryotic microbes, such as yeast cultures, may also be used. Saccharomyces cerevisiae, or common baker's yeast is the most commonly used among eukaryotic microorganisms, although a number of other strains arecommonly available. For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb, et al, Nature, 282: 39 (1979); Kingsman et al, Gene 7: 141 (1979); Tschemper, et al, Gene 10: 157(1980)) is commonly used. This plasmid already containsthe trp1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85: 12 (1977)). The presence of the trp1 lesion as a characteristic of theyeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
Suitable promoting sequences in yeast vectors include the promoters for 3-phosphoglycerate kinase (Hitzeman, et al., J. Biol. Chem., 255: 2073 (1980)) or other glycolytic enzymes (Hess, et al., J. Adv. Enzyme Reg., 7: 149 (1968); Hotland, etal, Biochemistry, 17: 4900 (1978)), such as enolase, glyceraldehyde-3-phosphatic dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase,phosphoglucose isomerase, and glucokinase. In constructing suitable expression plasmids, the termination sequences associated with these genes are also ligated into the expression vector 3' of the sequence desired to be expressed to providepolyadenylation of the mRNA and termination. Other promoters which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradativeenzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization (Holland, ibid). Any plasmid vector containing yeast-compatible promoter, originof replication and termination sequences is suitable.
In addition to microorganisms, cultures of cells derived from multicellular organisms may also be used as hosts. In principle, any such cell culture is workable, whether from vertebrate or invertebrate culture. However, interest has beengreatest in vertebrate cells, and propagation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years [Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)]. Examples of such useful host cell linesare VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and W138, BHK, COS-7 and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located in front of the gene to beexpressed, along with any necessary ribosome binding sites, RNA splice sites, polyadenylation site, and transcriptional terminator sequences.
For use in mammalian cells, the control functions on the expression vectors are often provided by viral material. For example, commonly used promoters are derived from polyoma. Adenovirus 2, and most frequently Simian Virus 40 (SV40). Theearly and late promoters of SV40 virus are particularly useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication (Fiers, et al, Nature, 273: 113 (1978) incorporated herein by reference. Smaller or larger SV40 fragments may also be used, provided there is included the approximately 250 bp sequence extending from the Hind III site toward the BglI site located in the viral origin of replication. Further, it is also possible, and oftendesirable, to utilize promoter or control sequences normally associated with the desired gene sequence, provide such control sequences are compatible with the host cell systems.
An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral (e.g. Polyoma, Adeno, VSV, BPV, etc.) source, or may be provided by the host cellchromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter is often sufficient.
C. Methods Employed
If cells without formidable cell wall barriers are used as host cells, transfection is carried out by the calcium phosphate precipitation method as described by Graham and Van der Eb, Virology, 52: 546 (1978). However, other methods forintroducing DNA into cells such as by nuclear injection or by protoplast may also be used.
If prokaryotic cells or cells which contain substantial cell wall constructions are used, the preferred method of transfection is calcium treatment using calcium chloride as described by Cohen, F. N. et al Proc. Natl. Acad. Sci. (USA), 69:2110 (1972).
Construction of suitable vectors containing the desired coding and control sequences employ standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to form the plasmids required.
Cleavage is performed by treating with restriction enzyme (or enzymes) in suitable buffer. In general, about 1 .mu.g plasmid or DNA fragments is used with about 1 unit of enzyme in about 20 .mu.l of buffer solution. (Appropriate buffers andsubstrate amounts for particular restrictions enzymes are specified by the manufacturer.) Incubation times of about 1 hour at 37.degree. C. are workable. After incubations, protein is removed by extraction with phenol and chloroform, and the nucleicacid is recovered from the aqueous fraction by precipitation with ethanol.
If blunt ends are required, the preparation is treated for 15 minutes at 15.degree. with 10 units of Polymerase I (Klenow), phenol-chloroform extracted, and ethanol precipitated.
Size separation of the cleaved fragments is performed using 6 percent polyacrylamide gel described by Goeddel, D., et al, Nucleic Acids Res., 8: 4057 (1980) incorporated herein by reference.
For ligation approximately equimolar amounts of the desired components, suitably end tailored to provide correct matching are treated with about 10 units T4 DNA ligase per 0.5 .mu.g DNA. (When cleaved vectors are used as components, it may beuseful to prevent religation of the cleaved vector by pretreatment with bacterial alkaline phosphatase.)
For analysis to confirm correct sequences in plasmids constructed, the ligation mixtures are used to transform E. coli K12 strain 294 (ATCC 31446), and successful transformants selected by ampicillin resistance where appropriate. Plasmids fromthe transformants are prepared, analyzed by restriction and/or sequenced by the method of Messing, et al, Nucleic Acids Res., 9:309 (1981) or by the method of Maxam, et al, Methods in Enzymology, 65:499 (1980).
EXAMPLES
The following examples are intended to illustrate but not to limit the present invention.
Synthesis and Expression of Human IGF-1
Enzymes were obtained from the following suppliers: New England Biolabs: restriction enzymes, T4 DNA ligase Bethesda Research Labs: restriction enzymes, Bact. Alkaline Phos. Boehringer-Mannheim: E. coli DNA Polymerase I (Klenow) P+LBiochemicals: Polynucleotide kinase, Terminal Nucleotidyl Transferase New England Nuclear: pBR322 [oligo(dG)-tailed] DNA Reagents: BioRad: Bis Acrylamide, Acrylamide, TEMED Sigma: Ammonium Persulfate Amersham: 10218.gamma..sup.32P ATP-5000 Ci/mmol; 10165.alpha..sup.32P dCTP>400 Ci/mmol. Solutions and Media: 1.times.TBE: 054M Tris Base, 0.54 M Boric Acid, 0.017 M Na.sub.2 EDTA. Difco: Yeast Nitrogenous Base (YNB); Tryptone, Yeast Extract, Bacto-Agar; Casamino Acids. Autoradiography: Kodak X-0 matAR XAR-2 Film Glass Beads: 0.45-0.60 mM B. Braun Melsungen AG LB medium (per liter): 10 g NaCl; 5 g yeast extract; 10 g tryptone; 0.17 ml NaOH (50 percent) LB Agar (per liter): 10 g tryptone; 5 g yeast extract; 0.5 g NaCl; 15 g Bacto-Agar adjusted to pH7.5 with NaOH. Antibiotics: Tetracycline (5 .mu.g/ml) in all mediums; Ampicillin (20 .mu.g/ml) in all mediums (plates or liquid) M9 Medium (per liter): 6 g Na.sub.2 HPO.sub.4 (anhydrous); 1 g NH.sub.4Cl; 3 g KH.sub.2PO.sub.4; 0.5 g NaCl; 1 mMMgSO.sub.4; 0.5 percent (w/v) glucose; 0.5 percent (w/v) Casamino Acids; 0.0001 percent Thiamine-HCl. YNB-CAA (per liter): 6.7 g Yeast Nitrogenous Base (without Amino Acids); 10 mg adenine; 10 mg uracil; 5 g Casamino Acids; 20 g Glucose. YNB-CAA agarplates (per liter): Same as YNB-CAA +30 g agar. Standard Ligation Conditions: 10-fold molar excess of insert (for linker) to vector. 1.times.T4 DNA ligase buffer and 400-800 U T4 DNA ligase; 14.degree.-12-16 hours. Standard Kination Conditions:1.times. Polynucleotide kinase buffer, 15 U polynucleotide kinase; 37.degree.60 minutes; followed by reaction termination by heating to 65.degree. for 10 minutes. 1.times. Kinase Buffer: 70 mM Tris-HCl (pH 7.6); 10 mM MgCl.sub.2; 5 mM DTT 1.times.T4DNA Ligase Buffer: 50 mM Tris-HCl (pH 7.8); 10 mM MgCl.sub.2; 20 mM DTT; 1 mM rATP. Construction, Strategy and Selection of a DNA Sequence
The 1.degree. protein structure of the human IGF-1 molecule has been determined (1). Based upon this protein sequence and the genetic code, a DNA sequence coding for mature human IGF-1 protein, including all possible base substitutions at anyone base position, was determined by computer analysis (Genentech Untrans Program). Using a restriction site analysis program (Genentech Asearch Program), all potential restriction sites located in all possible DNA sequences consistently coding for thesame protein were found. Three sites internal to the coding sequence were selected: PstI, BamHI, and AvalI. Two additional sites were placed at the ends, just outside of the coding sequence of the mature protein: one EcoRI site before the initiationcodon, AUG, and the StilI site following the termination codon, TAG of the coding sequence. The choice of these sties facilitated the cloning of the coding sequence in separate parts, each of which subsequently could be excised and then assembled toform an intact synthetic IGF-1 gene. This construction involved in the assembly of 4 parts, 2 parts forming the left half, 2 parts forming the right half. Each part consisted of two single strands of chemically synthesized DNA (see FIG. 1; SEQ ID NOS. 14-21). Proposed synthetic fragments were also analysed for internal complementarit y.
The constructions used to generate these four parts employed the use of DNA Polymerase I repair synthesis of synthetic oligonucleotide substrates having 9-10 bp stretches of complementary sequence at their 3' termini. In the presence of DNAPolymerase I (Klenow) and the four deoxynucleotide triphosphates, these primer-templates were extended to become full-length double-stranded DNAs. To prevent priming at locations other than the desired portions as well as self-hybridizations, each setof single-stranded DNAs were analysed by a computer program (Genentech Homology Program), and wherever possible, sequences which would have potentially led to hairpin loops, self-priming, or mis-priming, were eliminated by alternate codon usage. Each ofthese four double-stranded DNAs were synthesized to include 9-12 additional bp of non-IGF-1 coding DNA at each end (see FIG. 2; SEQ ID NOS. 22-29). This additional DNA was included to allow generation of sticky ends by restriction enzyme digestion. The sticky ends thus formed facilitated the ligation of the double-stranded pieces to contiguous coding sections of the synthetic gene or into a cloning vehicle.
The 9-12 extra bp of double stranded DNA beyond the restriction site at the end of each part (see FIG. 2; SEQ ID NOS. 22-29) allowed for the TdT-mediated formation of single-stranded oligodeoxycytidine strands at the 3' ends of eachdouble-stranded DNA section. These oligodeoxycytidine tailed double-stranded DNAs could then be annealed into a complementary oligodeoxyguanosine tailed PstI site of a cloning vehicle. Once cloned, and sequenced to ensure the correct base sequences,the parts could be easily isolated and ligated following restriction enzyme cleavage at the restriction sites selected at the ends of each of the four parts, to form the intact synthetic IGF-1 gene.
The method used successfully here was similar to that described by Rossi et al. (28); however, attempts at the construction and cloning of the IGF-1 coding sequence using the Rossi et al. method (28) with only two base pairs of extra DNA beyondthe restriction enzyme recognition sites repeatedly failed. The method employed here also differs from the Rossi et al. procedure (28) in that restriction sites placed at both ends of a double stranded DNA allow for the convenience of cloning eachdouble stranded DNA fragment, individually, by (dC)-tailing and annealing into a (dG)-tailed vector, a method which in practice requires less of the dobule stranded DNA than three-part ligations.
Chemical Synthesis
Eight fragments, 43, 43, 46, 46, 46, 46, 54, and 46 bases in length (see FIG. 1; SEQ ID NOS. 14-21), were chemically synthesized according to the method of Crea and Horn (2), the only change being the use of mesitylene nitrotriazole as thecondensing agent rather than 2,4,6-Triisopropyl benzenesulfonylchloride tetrazole.
The syntheses of the fragments were accomplished from the appropriate solid support (cellulose) by sequential addition of the appropriate fully-protected dimer- or trimer-blocks. The cycles were carried out under the same conditions as describedin the synthesis of oligothymidilic acid (see Crea et al., supra). The final polymers were treated with base (aqueous conc. NH.sub.3) and acid (80 percent HoAc), the polymer pelleted off, and the supernatant was evaporated to dryness. The residue,dissolved in 4 percent aq. NH.sub.3, was washed with ethyl ester (3.times.) and used for the isolation of the fully deprotected fragment.
Purification was accomplished by electrophoresis using 20 percent polyacrylamide gels. The pure oligonucleotide was ethanol precipitated following gel elution.
225-285 pmoles of each chemically synthesized fragment was mixed with an equivalent amount of the complementary single-stranded DNA fragment (i.e. 1L+3L; 2L+4L; 1R+3R; 2R+4R) in the presence of deoxyribonucleoside triphosphates at a finalconcentration of 200 .mu.M with the exception of dCTP. dCTP was added to a concentration of 5 .mu.M as a .alpha..sup.32 P-labeled isotope (with a specific activity of 1000-2000 Ci/mmol) to allow easy monitoring to the repair-synthesis reaction product. The reactions were carried out in a buffer containing a final concentration of 50 mM Tris HCl pH 7.5; 20 mM MgCl.sub.2; 20 mM DTT and 154 DNA Polymerase 1 (Klenow) in a reaction volume of 200 .mu.l. Reactions were allowed to proceed at 4.degree. for12-18 hrs.
Upon completion, EDTA was added to a concentration of 25 mM. Sample buffer containing the mixes were phenol extracted, CHCl.sub.3 extracted 2.times., and products were etOH precipitated. Pellets were taken up in 0.3 M NaOAc and the DNA wasreprecipitated with etOH. After dissolving the pellets in H.sub.2O, the 1L+3L and 2L+4L products were then digested separately with PstI in 100 .mu.l reaction mixes containing 1.times.PstI buffer (50 mM (NH.sub.4).sub.2 SO.sub.4, 20 mM Tris HCl pH 7.5,10 mM MgCl.sub.2), and 70 U PstI. After 4 hrs, EDTA was added to a concentration of 10 mM, and the material was ethanol precipitated. Pellets were then taken up in 0.3 M NaOAc and reprecipitated, then taken up in H.sub.2O. The PstI-digested 1L+3Lproduct was digested with EcoRI at 37.degree. in a 100 .mu.l reaction mix 1.times.EcoRI buffer (150 mM NaCl, 6 mM Tris HCl pH 7.5, 6 mM MgCl.sub.2 ) and 70 U EcoRI. The PstI digested 2L+4L product was digest at 37.degree. with BamHI in a 100 .mu.lreaction mixed in 1.times.BamHI Buffer (150 mM NaCl, 6 mM Tris HCl pH 7.9, 6 mM MgCl.sub.2) and 70 U BamHI. After 4 hrs, EDTA was added to both mixtures, and sample buffer was added. They were electrophoresed on a 6 percent polyacrylamide stab gel. Six percent slab gels were cast with a mixture containing 6 percent (w/v) acrylamide (20 to 1 ratio of acrylamide to Bis acrylamide) 1.times.TBE, 1 percent APS and 0.1 percent TEMED. Reaction products were located on the gel by autoradiography and theband corresponding to the 45 bp EcoRI-PstI digested 1L+3L product (Part 1) (see FIG. 3; SEQ ID NOS. 30-32) and the band corresponding to the 50 bp PstI-BamHI digested 2L+4L product (Part 2) (see FIG. 3; SEQ ID NOS. 33-35) were excised from the gel, andthe material was electroeluted in 0.2.times.TBE, phenol extracted, CHCl.sub.3 extracted, and ethanol precipitated. Parts 1 and 2 were dissolved in H.sub.2O.
Cloning Vector Prep
Cloning vector was prepared by digesting 20 .mu.g pBR322 (15) with 50 U EcoRI and 60 U BamHI, in 1.times.RI Buffer at 37.degree. for 6 hr. After addition of EDTA to a concentration of 10 mM, sample buffer was added, and the mixture was run on a5 percent polyacrylamide gel. The gel was developed by staining 10' in H.sub.2O containing 5 .mu.g/ml Et. Bromide, rinsing 2.times. in H.sub.2O and placing upon a UV transilluminator (302 mM). The band corresponding to ca. 3712 bp EcoRI-BamHIdigested pBR322 molecules was cut from the gel. The DNA was electroeluted from the gel slice, phenol extracted, CHCl.sub.3 extracted 2.times., and ethanol precipitated. The pellet was dissolved in H.sub.2O and was ready for ligation.
Ligation
In a three-part ligation (see FIG. 4), in which the molar ratio of inserts to vector in the ligation reaction was approximately 10 to 1, parts 1 and 2 were ligated into the EcoRI-BamHI digested 322 vector in 1.times.T4 DNA ligase buffer (cont. 50mM Tris HCl pH 7.8; 10 mM MgCl.sub.2, 20 mM DTT, 1 mM rATP) and .sup..about.800 U T4 DNA ligase (NEB). The reaction was carried out at 14.degree. for 12-16 hrs.
Transformations
E. coli strain 294 was used as the transformation host, using the procedure of M. Dagert and S. D. Ehrlich (3). The transformed cells W were plated on LB-agar plates containing ampicillin (20 .mu.g/ml; LB-Amp-plates) and transformants werescreened and grown in LB medium containing ampicillin at 20 .mu.g/ml ampicillin. Transformants were screened using a modification of the rapid miniscreen method of Birnhoim and Doly (4). Miniprep DNA prepared as such was digested with EcoRI and BamHIand run on polyacrylamide slab gels. Several transformants which illustrated a ca. 218 bp EcoRI-BamHI insert were grown in large scale and plasmids from each were isolated and sequenced according to the procedure of Maxam and Gilbert (5) to confirm thecorrect chemical synthesis and construction. The pBR322 vector containing the complete correct left half sequence of IGF-1 was called IGF-1 LH322 (see FIG. 5; SEQ ID NOS. 36-41).
Cloning of Fragments of the Right Half of IGF-1
Using the identical conditions of DNA Polymerase I-mediated repair-synthesis, the two pairs of fragments comprising the right half of the synthetic IGF-1 were converted into double-stranded DNAs. After the DNA Polymerase I reactions, and withoutenzymatic digestion, the 1R+3R (Part III) and 2R+4R (Part IV) reactions were run on a 6 percent polyacrylamide slab gels. The 83 bp (Part III) and 91 bp (Part IV) bands were located by autoradiography and cut from the gel. After electroelution theethanol precipitated double-stranded DNAs were dC-tailed (see FIG. 6) using the procedures of Villa-Komaroff et al. (6) and Rowenkamp and Firtel (7). Reactions were carried out in 50 .mu.l vols. of 1.times.tailing mix (cont. 0.2M Pot. Cacodylate, 25mM Tris HCl pH 6.9, 2 mM DTT, 0.5 mM CoCl.sub.2) and 22 .mu.m dCTP. After prewarming at 37.degree. for 10'', The 150 second reaction was begun by the addition of 10-20 units of terminal nucleotidyl transferase and terminated by addition of EDTAfollowed by phenol extraction, CHCl.sub.3 extraction 2.times., and ethanol precipitation.
These oligo (dC) tailed Parts III and IV were then separately mixed with equimolar amounts of oligo (dG)-tailed PstI cut pBR322 vector in 50 .mu.l of 1.times.annealing buffer (0.1M NaCl; 10 mM Tris HCl pH 7.8, 1 mM EDTA) at a final DNAconcentration of 1-2 .mu.g/ml. After heating to 75.degree. C., the mixes were gradually cooled to 4.degree. over a period of 16 hr and the mix transformed into competent E. coli 294 cells prepared according to the procedure of Dagert and Ehrlich (3). Transformed cells were plated on LB-Tetracycline-Agar plates and grown in LB-Tetracycline medium at tetracycline concentrations of 5 .mu.g/ml. Tetracycline resistant transformants were picked and plated onto LB-Ampicillin-Agar plates to check forinsertions at the PstI site. Several tetracycline resistant, Ampicillin-sensitive colonies for each Part 3 and 4 were miniscreened and those exhibiting insertions at the PstI locus were grown in large scale and sequenced by the Maxam and Gilberttechnique (5) to confirm the correct DNA sequences of Parts 3 and 4. Construction of an Intact Synthetic HuIGF-1 Coding Sequence
Preparation: Parts 3 and 4
Parts 3 and 4 Were separately removed from their vectors by digestions of 20 .mu.g of each vector with AvalI in 2.times.AvalI buffer (60 mM NaCl, 6 mM Tris-HCl (pH 8.0); 10 nM MgCl.sub.2; 6 mM 2-mercaptoethanol) and 30 U of AvalI. After 6hr., at37.degree., EDTA was added to the 150 .mu.l reactions to a concentration of 15 mM and the material phenol extracted, CHCl.sub.3 extracted 2.times. and ethanol precipitated. The Part 3 pellet was then taken up in 1.times.BamHI buffer and digested in avolume of 150 .mu.l with 30 U BamHI at 37.degree. for 4 hr. The pellet containing Part 4 was digested with 30 U SalI in 150 .mu.l of 1.times.SalI buffer at 37.degree. for 4 hr.
Both digests were then run on 6 percent polyacrylamide slab gels and stained. The 51 bp band representing Part 3 and the 62 bp band representing Part 4 were removed from the gels and the DNA was electroeluted, phenol extracted, CHCl.sub.3extracted 2.times. and ethanol precipitated. Pellets were then taken up in H.sub.2O and were ready for ligation.
Vector Preparation
20 .mu.g of the IGF-1 LH322 vector was digested with 50 U of BamHI and 50 U of SalI in a 200 .mu.l reaction containing 1.times.BamHI buffer at 37.degree. for 6 hr. After addition of EDTA to a concentration of 15 mM, the digestion mix was run ona 6 percent polyacrylamide slab gel, ethidium bromide stained and the 3814 bp band excised from the gel.
After electroelution, phenol extraction, chloroform extraction and ethanol precipitation, the DNA pellet was taken up in H.sub.2O and was ready for ligation with Parts 3 and 4 in a three-part ligation. The ligation was performed under conditionsdescribed above for a three-part ligation (see FIG. 7; SEQ ID NOS. 42-43). Parts 3 and 4 were present in the ligation mix at a 10-fold molar excess of inserts to vector. The mix was transformed into competent E. coli 294 cells prepared according tothe Dagert and Ehrlich procedure (3) and plated onto LB-Ampicillin plates. Several transformants were miniscreened and two clones exhibiting a ca. 115 bp BamHi-SalI fragment were grown in large scale and their plasmids prepared. Both strands of theintact synthetic gene were sequenced by the Maxam,-Gilbert technique (5) to confirm the correct sequence. The pBR322 plasmid containing the complete correct sequence coding for Human IGF-1 was called pBR322 HuIGF-1.
Human IGF-1 Expression
IGF-1 Fusion Expression in Bacteria
Initial attempts were to obtain expression of IGF-1 as a fusion protein. To accomplish this, both the pNCV (9) and the pNCVsLE (10) expression vectors were used. (The pNCVsLE expression vector is a derivative of the pNCV vector and was preparedas follows: pNCV was treated with BgII, which cleaves at the 13 codon of the LE fusion. The site was converted to an ECoRI cleavage site using synthetic DNA, to give the expression vector pNCVsLE. The synthetic DNA introduced into the plasmid has thesequence:
5'-GATCCAGAATTC (SEQ ID NO. 1)
5'-GATCGAATTCTG (SEQ ID NO. 2) and this sequence was introduced into the plasmid:
TABLE-US-00001 GATCCAGAATTC SEQ ID NO. 1 GTCTTAAGCTAG SEQ ID NO. 2
As a strategy to release the fused human IGF-1 protein from the trp fusion protein, a linker was designated such that an enzymatic proteolysis method reported by Wunsch et al. (8) could be applied to this expression system. To accomplish this, aDNA linker:
TABLE-US-00002 ProAla 5'- AATTCCCTGCCG -3' SEQ ID NO. 3 3' GGGACGGCCAG -5' SEQ ID NO. 4
was chemically synthesized by standard methods (2) which when linked to the trp fusion protein and the IGF-1 gene, coded for the amino acid residues Proline and Alanine followed by Glycine and Proline which are the first two amino acid residuesof IGF-1 and preceded by Proline and Alanine together comprise a recognition site for a collagenase isolated from Clostridium histolyticum (11,212). This enzyme reportedly acts at such a site to cleave the alanineglycine peptide bond.
To construct a DNA sequence coding for a fusion protein with a callagenase cleavage site, 30 .mu.g pBR322 HuIGF-1 plasmid was cleaved with 50 U BamHI and 50 U PvuI enzyme in 200 .mu.l 1.times.BamHI buffer at 37.degree. for 6 hours. Afteraddition of EDTA to a concentration of 15 mM, the reaction mix was chromatographed on a 6 percent polyacrylamide slab gel. The smaller PvuI-BamHI fragment (.sup.-725 bp) was isolated and digested with 40 U AvalI in 150 .mu.l 1.times.Sau96I buffer (60 mMNaCl, 6 mM Tris-HCl pH 7.4, 15 mM MgCl.sub.2, 6 mM 2-mercaptoethanol). After addition of EDTA to a concentration of 15 mM, the resulting mix chromatographed on a 6 percent polyacrylamide slab gel. The smaller Sau96I-BamHI fragment (.about.86 bp) wasextracted from the gel, phenol extracted, chloroform extracted 2.times., and ethanol precipitated. This fragment was ready for ligation.
200 pmols of linker fragments were kinased with 100 U polynucleotide kinase in 20 .mu.l of 1.times.polynucleotide kinase buffer (70 mM Tris-HCl (pH 7.6); 10 mM MgCl.sub.2; 5 mM DTT; 1 mM rATP) at 37.degree. for 1 hour. The reaction wasterminated by heating to 65.degree. C. for 5 minutes. 100 pmols of the kinased linker fragments were ligated to the 86 bp Sau96I-BamHI fragment with 400 U of T4 DNA ligase in 30 .mu.l of 1.times.T4 DNA ligase buffer at 14.degree. for 12-16 hours. Theligation reaction was terminated by addition of EDTA to a concentration of 15 mM followed by pheno extraction, chloroform extraction 2.times., and ethanol precipitation. The pellet was then taken up in 1.times.BamHI buffer and digested in a 100 .mu.lreaction with 50 U of EcoRI and 50 U of BamHI at 37.degree. for 6 hrs. After terminating the digestion with EDTA, the mixture was chromatographed on a 6 percent polyacrylamide slab gel and the newly created (.about.97 bp) EcoRI-BamHI fragment wasextracted from the gel, and prepared for ligation. The vector to receive this new fragment was prepared by digesting 30 .mu.g pBR322 HuIGF-1 with 100 U of each EcoRI and BamHI in 100 .mu.l of 1.times.BamHI buffer at 37.degree. for 8 hr. The reactionwas terminated, chromatographed on a 6 percent polyacrylamide slab gel and the larger band (.about.3830 bp) representing the EcoRI-BamHI digested plasmid was isolated and the plasmid DNA extracted and prepared for ligation as above. In a 30 .mu.lligation reaction containing a 10-fold molar excess of insert fragment to vector, the EcoRI-BamHI fragment was ligated into the EcoRI-BamHI digested plasmid pBR322 HuIGF-1 under standard ligation conditions mentioned above. Competent E. coli 294,prepared as above (3), were used as transformation hosts and the transformed cells were plated onto LB-Ampicillin agar plates. Several transformants were picked, miniscreened as above (4), and two exhibiting an EcoRI-BamHI insertion were grown in largescale and their plasmids purified. Using the Maxam-Gilbert procedure (5) the construction was sequenced to verify the correct synthesis and insertion of the EcoRI-Sau96I collagenase linker. This plasmid Was called pBR322 HuSynIGF-1-M.
To prepare this EcoRI-SalI IGF-1 coding sequence for insertion into pNCV and pNCVsLE, 30 .mu.g of pBR322 HuSynIGF-1-M was digested with 70 U of SalI in 200 .mu.l of 1.times.SalI buffer (150 mM NaCl, 6 mM Tris-HCl (pH 7.9); 6 mM MgCl.sub.2; 6 mM2-mercaptoethanol) at 37.degree. for 6 hours. After addition of EDTA to 15 mM, the mixture was phenol extracted, chloroform extracted 2.times., and ethanol precipitated.
Using standard chemical synthesis procedures (2) a SalI-EcoRI linker
TABLE-US-00003 5' TCGACGTACATG 3' SEQ ID NO. 5 3' GCATGTACTTAA 5' SEQ ID NO. 6
was synthesized and 400 pmols kinased, as above. 200 pmols of the kinased linker was ligated to the SalI digested pBR322 HuSynIGF-1-M (prepared above) with 800 U T4 DNA ligase in 30 .mu.l of 1.times.ligation buffer for 12-16 hours at 14.degree. C.
After termination of the reaction with EDTA, the mixture was phenol extracted, chloroform extracted 2.times., and ethanol precipitated. The pellet was then taken up in 1.times.EcoRI buffer and digested with 100 U EcoRI in a volume of 200 .mu.lfor 8 hours at 37.degree.. After addition of EDTA to a concentration of 15 mM, the mixture was chromatographed on a 6 percent polyacrylamide slab gel. The gel was stained and the .about.230 bp band corresponding to the EcoRI-EcoRI HuIGF-1 fragment wasextracted from the gel, phenol extracted, chloroform extracted 2.times., and ethanol precipitated. This fragment was ready for ligation into pNCV and pNCVsLE, pNCV and pNCVsLE were prepared for ligation by digestion of 20 .mu.g of each with 100 U EcoRIin 200 .mu.l.times.EcoRI buffer at 37.degree. for 8 hours. After digestion, 200 U of bacterial alkaline phosphatase was added to each reaction and the mixtures were warmed to 65.degree. C. for 2 hours. EDTA was added to a concentration of 15 mM andthe mixes were phenol extracted 3.times., chloroform extracted 2.times. and then ethanol precipitated. These expression vectors were prepared for ligation.
Ligations of the EcoRI-EcoRI Human IGF-1 fragment into the two expression vectors were performed in 30 .mu.l reaction volumes in 1.times.T4 DNA ligase buffer with 800 U T4 DNA ligase at 14.degree. for 12-16 hours. The EcoRI-EcoRI fragment waspresent at a 10-fold molar excess in vector.
Competent E. coli 294 were prepared (3) (ATCC 31446) and used as transformation hosts for the ligations. Transformed cells were plated onto LB-agar plates containing tetracycline (5 .mu.g/ml; LB-Tet-plates) and transformants were miniscreened(4). Miniscreen plasmid DNA from transformants of the pNCV-IGF-1 construction were digested with both PstI and BGIII to determine the orientation of the EcoRI fragment insertions. Two clones whose plasmids contained a .about.570 bp BgIII-PstI fragment(as opposed to a .about.690 bp fragment) were grown in large scale and their plasmids prepared. The construction was sequenced using the Maxam-Gilbert procedure (5) to confirm the correct insertion at the junction of the trp fusion and IGF-1 proteincoding sequences as well as retention of the desired reading frame. Plasmids with the correctly inserted IGF-1 fragment were called pNCVLE-IGF-1. Transformants of the pNCV-sLE-IGF-1 construction were also miniscreened by the same procedure (5), and theplasmid DNAs were digested with HincII and PstI. Two clones exhibiting a .about.150 bp HincII-Pstl fragment (as opposed to a .about.105 bp HincII-HincII fragment) were grown in large scale and their plasmids prepared. Using the Maxam-Gilbert techniques(5), the functions of the trp fusion and IGF-1 protein coding sequences were sequenced to ascertain proper orientation and retention of the proper reading frame. Those plasmids possessing the correct insertion and proper reading frame were calledpNCV-sLe-IGF-1.
To attempt expression of each of these constructions, two clones, one possessing pNCV-IGF-1 and the other possessing pNCV-sLE-IGF-1, were inoculated into 10 ml M9-Tetracycline culture medium supplemented with 0.5 mg/ml Tryptophan. A clonecontaining pNCV-LE with no IGF-1 gene insert was also inoculated into culture medium to provide as a negative control in assays.
After 12-16 hours growth at 37.degree. with agitation, 0.5 ml of these cultures were used to inoculate 250 milliliters of M9-Tetracycline culture medium. After growing for 12-16 hours at 37.degree. with agitation, the cells were harvested bycentrifugation at 5000 rpm for 10 minutes in a Sorvall GSA rotor. The refractile bodies were purified from the pelleted cells by: a) suspending the host cells in a buffered solution of ionic strength suitable to solubilize most of the host protein, b)subjecting the suspension to cell wall/membrane disruption, c) centrifuging the disrupted suspension at low speed to form a pellet, optionally repeating the foregoing steps, and d) recovering the heterologous protein as refractile bodies in the pellet(Reference 13). A small quantity of refractile particles of each of the three preparations was boiled in SDS and 2-mercaptoethanol containing sample buffer and run on SDS-polyacrylamide slab gels according to the Laemmli method (14). The size of theprotein expressed by pNCV-IGF-1 (LE-IGF-1) was .about.28,670 Daltons (see FIG. 7; SEQ ID NOS. 42-43), and .about.9770 Daltons for the pNCV-sLE-IGF-1 protein (sLE-IGF-1) (see FIG. 8; SEQ ID NOS. 44-45). These two expressed proteins were subjected tosolubilization in 6M Guanidine-HCl followed by 50-fold dilution with dilute buffers. The final buffer for pNCV-IGF-1 after dilution was 0.12 M Guanidine-HCl; 0.05 M 7922 Tris-HCl pH 8, 20 percent glycerol; 0.1 mg/ml BSA; 0.15 M NaCl; 0.1 mM EDTA and thefinal buffer after dilution of the pNCV-sLE-IGF-1 refractile bodies was 0.14 M Guanidine-HCl; 25 mM Tris-CHl pH 7.6; 10 mM CaCl.sub.2. After spinning out particulate matter, the two solutions containing solubilized trp-IGF-1 fusion proteins were assayedby a radioimmune assay procedure of Furlanetto et al. (23), as modified by Hintz et al. (24). Both fusion proteins demonstrated activity in this assay. A negative control prep was also included in the assay and the control exhibited no measurableactivity.
Expression and Secretion in Yeast
To avoid the necessity of refractile body purification and solubilization, from bacterial cell lysates, yeast expression-secretion systems were sought as an alternative. Aside from the advantage of avoiding protein purification from celllysates, coupled expression-secretion systems might obviate a subsequent in vitro processing step to remove a fused protein. Available were three yeast expression-secretion systems. These were: 1) yeast a factor (22), employing yeast .alpha.-factorpromoter and preprosequence; 2) yeast invertase (16) consisting of the invertase promoter and signal sequence; and 3) a hybrid composed of the PGK promoter (25) and invertase signal (16).
Yeast Alpha-Factor Promoter Pre-Alpha Factor IGF-1 Plasmid Construction
To obtain expression of IGF-1 using the a factor promoter and preprosequence, a plasmid constructed by Singh (22) was used. Plasmid P65 (FIG. 9) possesses sequences of the .alpha.-factor promoter, .alpha.-factor preprosequence, yeast 2 micronterminator, the yeast Trp 1 gene, as well as portions of the pBR322 plasmid. Plasmid p65 was obtained by its following method: The 15-mer oligonucleotide probes for the .alpha.-factor gene were designed on the basis of the amino acid sequence of thepheromone (23a) and yeast codon usage frequencies. The rationale is outlined in FIG. 19 (SEQ ID NOS. 57-60) where the last 5 amino acids of the .alpha.-factor and all the possible codons and their usage frequencies are given. (The codon usage is thetotal of 2 different glyceraldehyde-3-phosphate dehydrogenase clones (23b, 23c) and of alcohol dehydrogenase I.) The codon usage for these and other genes has recently been summarized identical, to the MF.alpha.1. The .alpha.-factor encoded by this geneis apparently made as a precursor protein of 120 amino acid residues containing two copies of the pheromone. One of the .alpha.-pheromone tridecapeptides contained in the putative precursor is identical to the pheromone copies encoded by the MF.alpha.1gene, whereas the second copy contains a Gln.hoarfrost.Asn and a Lys.fwdarw.Arg.
E. Construction of a Plasmid p65 for Expression and Secretion of Human Interferon
The preparation of a plasmid to demonstrate the usefulness of the .alpha.-factor promoter and the .alpha.-factor presequences for expression and secretion of heterologous gene products is outlined in FIGS. 23-24. The DNA sequences coding for the.alpha.-factor peptides were removed from one of the .alpha.-factor clones (p53) such that the resulting plasmid, p57, contained the promoter sequences and the sequence corresponding to 89 amino acids of the .alpha.-factor "prepro" protein. Thissequence was then joined with human interferon D (IFN-.alpha..sub.1) gene to form plasmid p58. For this purpose an expression plasmid p65 was constructed as shown in FIG. 24. This plasmid, like YEp9T, contains the origins of replication for E. coli andyeast as well as selective markers for selection in each of these two organisms. It also contains a convenient EcoRI site for gene insertion so that any gene that is contained on an EcoRI fragment where the first codon of the gene is immediatelypreceded by the EcoRI site could be tested for the synthesis and secretion of the corresponding protein. Due to the dearth of convenient restriction sites in the .alpha.-factor preprosequence, to insert the IGF-1 coding sequence, the identical.sup..about.230 bp EcoRI-EcoRI HuSynIGF-1-M fragment that was ligated into pNCV and pNCVsLE (as mentioned previously in bacterial construction) was used. This EcoRI-EcoRI fragment contained the collagenase recognition siteProline-Alanine-Glycine-Proline, and allowed for collagenase digestion should IGF-1 be secreted as a fusion protein. The protein expressed in this construction (see FIG. 10; SEQ ID NOS. 46-47) consists of the repro .alpha.-factor protein fused toIGF-1.
To insert the .sup..about.230 bp EcoRI-EcoRI fragment, the plasmid P65 was partially digested in 1.times.EcoRI buffer with EcoRI, and then sized upon a 0.7 percent horizontal agarose gel. The band corresponding to the linearized singularlyrestricted plasmid was excised, eluted from the gel, and phenol extracted, chloroform extracted 2.times., and then ethanol precipitated. This DNA pellet was then taken up in 50 mM Tris-HCl (pH 8) and treated with bacterial alkaline phosphatase underconditions to ensure 100 percent dephosphorylation of the 5' protruding ends. Following this treatment, the phosphatase activity was removed by first adding EDTA to a concentration of 15 mM, then extracting the DNA with phenol 3.times., chloroformextracting 2.times., and ethanol precipitating the vector. This material then contained linearized P65 vector, digested with EcoRI in either of two locations: one, either at the EcoRI site upstream of the .alpha.-factor promoter and preprosequence, orat another, at the EcoRI site just downstream of the .alpha.-factor promoter and preprosequence. The .sup..about.230 bp EcoRI-EcoRI IGF-1 fragment was ligated into the vector. The desired location of insertion was at the EcoRI site just downstream fromthe .alpha.-factor promoter and preprosequence.
The ligation was carried out under standard ligation conditions and the transformation hosts were competent E. coli 294 prepared according to Dagert and Ehrlich (3). The transformed cells were plated onto LB-Amp-Agar plates. Severaltransformants were miniscreened according to the method of Birnboim and Doly (4), and plasmid DNA prepared as such was digested with both SaLI and HINDIII in the appropriate buffers. One of several clones which contained a plasmid with an .about.110 bpEcoRI-HindIII fragment was grown in large scale and its plasmid was purified. This plasmid, YEp9T .alpha.-factor EcoRI-EcoRI IGF-1 (see FIG. 11), was used to transform competent yeast strain 20B-12 (atrp pep.sup.4) cells according to the Hitzemanmodification (19) of Hinnen et al. (17) and Beggs et al. (18) procedures.
Two such transformants, as well as a negative control transformant (with no IGF-1 insertion in the plasmid), were grown in suspension as were those of the yeast pre-invertase-IGF-1 plasmid transformations. Supernates were tested for secretedIGF-1 activity, as measured by the radioimmune assay procedure of Furlanetto et al. (23) as modified by Hintz et al. (24). Both supernates of transformants having plasmids with IGF-1 inserts contained IGF-1 activity and the negative control supernatedid not. One of these transformants was grown in large scale in a 10 liter fermenter and the supernate contained secreted IGF-1 activity at a peak level of .sup..about.3 .mu.g/ml. The IGF-1 activity of the fermentation supernate was also demonstratedby a placental membrane radioreceptor assay developed by Horner et al. (26).
Yeast Invertase Promoter Signal IGF-1 Plasmid Construction
Based upon evidence of correct processing and secretion in yeast of proteins with heterologous signal sequences (16), the yeast invertase expression-secretion system became of interest. Attempted first was expression of the yeast invertasesignal protein fused to IGF-1 (FIG. 12SEQ ID NOS. 48-49), coupled with the processing and secretion of IGF-1, using the invertase promoter as a starting point for transcription.
The yeast invertase signal coding sequence was attached to the IGF-1 gene by the use of a NcoI-HindIII (.sup..about.400 bp) fragment containing the initiation ATG codon and 5' end of the signal DNA sequence, and 4 DNA fragments synthesized bystandard procedures (2):
TABLE-US-00004 5' AGCTTTCCTTTTCCTTTTGGC 3' SEQ ID NO. 7 3' AAGGAAAAGGAAAACCGACCAA 5' SEQ ID NO. 8 5' TGGTTTTGCAGCCAAAATATCTGCAG 3' SEQ ID NO. 9 3' AACGTCGGTTTTATAGACGTCCAG 5' SEQ ID NO. 10
The construction began with the isolation of the 90 bp AvalI-BamHI IGF-1 left half fragment by AvalI digestion of a .sup..about.730 bp PvuI-VamHI fragment isolated from PvuI-BamHI digested pBR322-HuSynGF-1.
After phosphorylation of all four synthetic DNA fragments using standard kination conditons, the four synthetic fragments were mixed with the AvlI-BamHI IGF-1 left half fragment and ligated using standard ligation conditions. Followinginactivation of the ligase by phenol and chloroform extraction 2.times., the ethanol precipitated DNA pellet was dissolved and digested with HindIII and BamHI in the appropriate buffers. Newly constructed HindIII-BamHI (ca. 140 bp) fragment wasisolated and extracted from a 6 percent polyacrylamide gel. This material was then ligated into HindIII-BamHI digested pBR322 vector, which had been first digested with HindIII, then BamIII in the appropriate buffers, followed by purification of the4014 bp vector fragment from a 6 percent gel.
The transformation host was competent E. coli 294 prepared by standard procedures (3) and the transformed cells were plated onto LB-Ampicillin agar plates. Several tranformants were miniscreened by the Birnboim-Doly procedure (4) and theirplasmid DNAs digested with EcoRI and BamHI. Two plasmids containing a .sup. bp EcoRI-BamHI fragment (illustrating the insertion of a 140 bp fragment into the HindIII and BamHI sites) were grown in large scale and their plasmids prepared. UsingMaxam-Gilbert sequencing techniques (5), the entire 43 bp HindIII-AvalI section of DNA was sequenced to confirm the correct chemical synthesis and construction. The correctly constructed plasmid was called pBR322-P-I-HuSynIGF HindIII-BamHI(.sup..about.4154 bp).
To insert the right half of the IGF-1 gene, this newly created plasmid was digested with BamHI-SalI in the appropriate buffers and the larger fragment (.sup..about.3879 bp) was purified by gel fractionation. pBR322 HuSynIGF was digested withBamHI-SalI in the appropriate buffers and the 115 bp BamHI-SalI fragment corresponding to the right half of the IGF-1 gene was isolated by gel fractionation. This 115 bp BAMIII-SalI IGF-1 right half fragment was then ligated into the BamHI-SalI digestedpBR322-P-I-IGF-1 LH HindIII-BamHI vector using standard ligation conditions. Competent E. coli strain 294 prepared according to Dagert and Ehrlich (3) were used as transformation hosts and transformed cells were plated onto LB-Amp-Agar plates. Severaltransformants were miniscreened using standard techniques (4) and plasmid DNA prepared as such was digested with EcoRI and SalI in the appropriate buffers and those plasmids illustrating an insertion of the BamHi SalI fragment corresponding to the righthalf of IGF-1 were called PBR322 P-I-HuSynIGF-1 HindIII-SalI. One of the clones containing the pBR322 P-I-IGF-1 HindIII-SalI plasmid was grown in large scale and the plasmid was isolated. This plasmid was then digested with HindIII and SalI in theappropriate buffer to prepare a 255 bp HindIII-SalI fragment containing all of the IGF-1 gene and the 3' portion of the yeast invertase signal coding sequence. This fragment of DNA was isolated by polyacrylamide gel fractionation and prepared forligation by standard techniques. The (.sup..about.400 bp) Ncol-HindIII fragment containing the 5' end of the DNA sequence coding for the invertase signal as well as the yeast invertase promoter was created by NcoI and HindIII digestion of plasmidYlpsp-LelFA (16) in the appropriate buffers. The YIpsp-LelFA plasmid was first digested with NcoI to completion in the appropriate buffer, then phenol extracted, chloroform extracted 2.times. and ethanol precipitated. The linearized molecules werethen taken up in 1.times.HindIII buffer and partially digested to generate the needed NcoI-HindIII (.sup..about.400 bp) fragment which contains an internal HindIII restriction site. This NcoI-HindIII fragment was then isolated by gel fractionation andprepared for ligation using standard techniques. To provide for a vector, plasmid pUC12-YI (EcoRI-BamHI)(designated p4.3 kb in citation 16) was digested with NcoI and SalI in the appropriate buffers. After purification by gel fractionation, the.sup..about.2.6 kbp vector was eluted from the gel and prepared for ligation by standard techniques. To perform the final construction, a three-part ligation was arranged using standard ligation techniques. The DNA used in the ligation included theNcoI-SalI-digested pUC12-1 (EcoRI-BamHI) (16), the .sup..about.400 bp NcoI-HindIII and the .sup..about.255 bp HindIII-SalI fragments. After ligation, the material was transformed into competent E. coli 294 cells prepared according to Dagert et al. (3). Transformed cells were plated onto LB-Amp-Agar plates and several transformants were miniscreened using the procedure of Birnboim and Doly (4). Plasmid DNA prepared as such was digested with NcoI and SalI in the appropriate buffers and one of severalclones containing plasmids exhibiting the insertion of a .sup..about.625 bp NcoI-SalI DNA fragment was grown in large scale and its plasmid was purified.
As a final step, this plasmid was linearized by digestion with SalI in the appropriate buffer. SalI-EcoRI linker, prepared as mentioned above, and kinased under standard kination conditions, was ligated to the linearized vector to convert theSalI ends to EcoRI ends using standard ligation conditions. After termination of the ligation reaction by addition of EDTA to 15 mM, phenol extraction, chloroform extraction 2.times. and ethanol precipitation, the DNA pellet was dissolved in1.times.EcoRI buffer, and digested with EcoRI. The EcoRI digestion released a .sup..about.1150 bp EcoRI fragment which contained the yeast invertase promoter, yeast invertase signal coding sequence and the IGF-1 coding sequence in one contiguoussequence. This material was isolated as a .sup..about.1150 bp band from a 6 percent polyacrylamide slab get after fractionation and prepared for ligation using standard procedures.
The yeast-E. coli shuttle vector to receive the EcoRI fragment was prepared by EcoRI digestion of plasmid YEp9T (16) to-linearize the vector, followed by treatment of the EcoRI termini with bacterial alkaline phosphatase using conditionsrecommended by the manufacturer to produce 100 percent dephosphorylation of the 5' protruding ends. The phosphatase reaction was terminated by addition of EDTA to 15 mM and the mixture phenol extracted 3.times., chloroform extracted 2.times., and thenthe DNA was ethanol precipitated. After redissolving the DNA pellet in 1.times.ligation buffer, the vector was mixed with the EcoRI .sup..about.1150 bp fragment and ligated under standard ligation conditions. Competent E. coli 294 cells preparedaccording to Dagert et al. (3) were used as transformation hosts and the transformants were placed onto LB-Amp-Agar plates. To determine the orientation of the insertion, several transformants were miniscreened using the method of Birnboim and Doly (4)and plasmid DNAs purified as such were digested with BamHI in the appropriate buffer. One of several transformants possessing plasmids which produced a 1.3 kb BamHI-BamHI fragment upon BamHI digestion (as opposed to a .sup..about.475 bp fragment) wasgrown in large scale and its plasmid was purified. This plasmid, called P.I.IGF-1 EcorRI-EcoRI P.I. Promoter was used to transform competent yeast cells prepared essentially according to the methods of Hinnen, A., et al. (17), and Beggs, J. D. (18),but with the modification of Hitzeman (19). The yeast strain 20B-12 (.alpha.trpl pep4) was used and was obtained from the Yeast Genetics Stock Center. In this construction, the expression of IGF-1 begins With transcription at the invertase promoter andterminates in the yeast 2 micron sequence. The fusion protein expressed by this construction consisted of the yeast invertase signal fused to the IGF-1 protein, the combined molecular weight of which was 9964 Daltons. Another plasmid with the EcoRIfragment inserted in the reverse orientation was also used to transform competent yeast cells. In this construction, the IGF-1 was not provided with the yeast terminator.
Several transformants were picked and streaked on YNB-CAA agar plates. Among these, three transformants were picked and inoculated into 10 ml of YN3-CAA grow-up medium, in shake flasks. A fourth culture was also started using a colonytransformed with the same vector, but with the EcoRI fragment inserted into the vector in the reverse orientation. After 16-20 hours growth at 30.degree., the cultures were sampled (1 ml) and cleared of cells by spinning 5' in an eppendorf microfuge. Supernatants were taken off and assayed for secreted activity using the radioimmune assay procedure of Furlanetto et al. (23) as modified by Hintz et al. (24). The supernates of the three transformants demonstrated activities of 1.7 to 3.3 ng/ml ofIGF-1 activity and the negative control showed no activity. To determine intracellular activity, the pellets from 1 ml of culture were washed 1.times.in 25 mM Tris-HCl (pH 7.6), 1 mM EDTA and then lysed by 3-4 minutes of vigorous vortexing in 0.5 ml ofthe above Tris-EDTA solution with 0.4 ml of glass beads.
Assay of the cell lysates demonstrated IGF-1 activities of 1.5-2.8 ng/ml in the three IGF-1 secreting transformants and no activity in the negative control transformant. The highest secretor of the three transformants was grown in a 5 literfermentation and the secreted IGF-1 activity reached a peak of 74 ng/ml of supernate.
Yeast PGK Promoter Pre-Invertase IGF-1 Plasmid Construction
One difficulty in the use of the invertase promoter was that it was subject to repression in the presence of glucose. Due to the incompatibility of glucose with high levels of transcription initiation at the invertase promoter, the PGK promoterwas sought as an alternative promoter, glucose, being the mainstay carbon source of fermentation processes.
To begin construction of the PGK promoter P.I.IGF-1 construction, it was necessary to clone a fragment containing the entire invertase signal coding sequence. To do this, plasmid pLeIF-A-Invertase Signal (16) was digested with BgIII and thenBamHI in the appropriate buffers. This digestion released several fragments, one of which was a .sup..about.625 bp BgIII-BamHI fragment which was isolated from a 6 percent polyacrylamide slab gel and prepared for ligation using standard techniques. Toclone this fragment, the pUC8 vector was chosen as a cloning vehicle. pUC8 plasmid was digested with BamHI in 1.times.BamHI buffer, treated with bacterial alkaline phosphatase to dephosphorylate the 5' termini, and then run onto and purified from a 5percent polyacrylamide slab gel.
After standard preparation for ligation the BamHI digested vector was mixed with the above .sup..about.625 bp BgIII-BamHI fragment, and ligated under typical ligation conditions. The mixture was then transformed into competent E. coli 294prepared by the Dagert et al. method (3) and the transformed culture plated onto LB-Amp-Agar plates. Several transformants were picked and miniscreened using the Birnboim and Doly (4) technique. Miniscreen plasmid DNA was digested with EcoRI and ananalytical gel of the digests illustrated two types of plasmids having EcoRI fragments either .sup..about.260 bp or .sup..about.385 bp in length. One clone containing a .sup..about.260 bp EcoRI fragment was grown in large scale and its plasmid purified. This plasmid was called pUC8P.I. Promoter-Signal BgIII-BamHI.
A clone of this type was chosen because of the desired orientation of the inserted BgIII-BamHI fragment. What was needed from this plasmid was an .sup..about.20 bp EcoRI-HindIII fragment containing the ATG initiation condon and 5' end of theinvertase signal coding sequence.
To construct the intact invertase signal coding DNA sequence, .sup..about.150 bp HindIII-BamHI fragment containing the 3' end of the signal sequence fused to the left half of the IGF-1 gene was isolated from HindIII-BamHI digestion of plasmidpBR322 P.I. IGF-LH HindIII-BamHI (.sup..about.4154 bp). Isolation was by polyacrylamide slab gel fractionation, and the DNA band corresponding to the .sup..about.150 bp fragment was excised and prepared for ligation using standard techniques.
To obtain the short (.sup..about.20 bp) EcoRI-HindIII fragment, the plasmid pUC8 P.I. Promoter-Signal-BgIII-BamHI was digested with EcoRI in 1.times.EcoRI buffer. This digestion released the .sup..about.260 bp EcoRI-EcoRI fragment which wasisolated from a 6 percent polyacrylamide slab gel after fractionation of the digestion mixture. This .sup..about.260 bp fragment was then digested with HindIII in the appropriate buffer, causing the creation of two. HindIII-EcoRI fragments, one.sup..about.20 bp and the other .sup..about.240 bp in length. After complete digestion, the digestion was terminated by addition of EDTA to 15 mM and the entire mix phenol extracted, chloroform extracted 2.times., and then ethanol precipitated.
A vector was prepared by EcoRI-BamHI digestion of pBR322 (15) in the appropriate buffers followed by purification of the EcoRI-BamHI digested vector from a 5 percent polyacrylamide slab gel. After preparation for ligation using standardtechniques, the vector was mixed with the .sup..about.150 bp HindIII-BamHI fragment (3' end of invertase signal +Left Half IGF-1), and the two HindIII-EcoRI fragments (the .sup..about.20 bp fragment containing the 5' end of the invertase signal codingsequence), and the entire mixture was ligated under standard ligation conditions. Competent E. coli 294 prepared according to Dagert and Ehrlich (3) were used as transformation hosts for the ligation, and the transformed cells plated onto LB-Amp-Agarplates. Several transformants were miniscreened according to Birnboim and Doly (4) and the purified miniscreen DNAs were digested with EcoRI and BamHI. One of several clones possessing an .sup..about.170 bp EcoRI-BamHI fragment was grown in largevolume and its plasmid purified. This plasmid contained the complete yeast invertase signal coding sequence fused to the left half of IGF-1 and was called P.I. IGF-1 L.H. RI-BamHI.
The desired .sup..about.170 bp EcoRI-BamHI fragment was isolated from this plasmid by digestion of the plasmid with EcoRI and BamHI in the appropriate buffers followed by slab gel fractionation of the reaction mix. Using standard techniques, the.sup..about.170 bp band of DNA was prepared for ligation. To complete the construction, the right half of IGF-1 was isolated as an .sup..about.120 bp BAMHI-EcoRI fragment from the plasmid P.I. IGF-1 EcoRI-EcoRI-P.I. Promoter by digestion with EcoRIand BamHI in the appropriate buffers followed by elution from a gel slice after polyacrylamide slab gel fractionation of the digestion mixtures. These two fragments the .sup..about.170 bp EcoRI-BamHI and the .sup..about.120 bp BamHI-EcoRI, were ligatedtogether in vitro under standard ligation conditions, with both fragments present in roughly equimolar concentrations. This ligation mixture was then terminated by the addition of EDTA to .sup..about.15 mM followed by phenol extraction, chloroformextraction 2.times., and ethanol precipitation. The DNA pellet was then taken up in 1.times.ExoRI buffer and digested with EcoRI. The digest was then run on a 6 percent polyacrylamide slab gel and the DNA band staining at .sup..about.290 bp (as opposedto .sup..about.340 bp and 240 bp) was excised and prepared for ligation using standard techniques. This .sup..about.290 bp EcoRI-EcoRI fragment contained the entire yeast invertase signal coding sequence fused to the complete IGF-1 coding sequence.
To express this protein, it was necessary to select a yeast vector with a promoter. The PGK promoter of the plasmid YEp1PT Small (see FIG. 13) was used. YEp1PT Small was constructed as a derivative of YEp1PT (21) by ClaI and PvulI digestion ofYEp1PT in the appropriate buffers. The ClaI 5' protruding end was converted to a blund end by use of DNA polymerase 1 (Klenow) under conditions recommended by the vendor. After blunting the (ClaI protruding ends, the blunt ends ClaI and PvulI) of thelinearized vector were fused using T4 DNA ligase under standard ligation conditions. The resultant YEp1PT small vector was .sup..about.5.9 kbp in size (or .about.2.7 kbp smaller than YEp1PT). Just as YEp1PT, YEp1PT small possesses the 2 micron originand terminator, the PGK promoter, the TRP1 gene, and sequences from pBR322, including the .beta.-lactamase gene.
YEp1PT Small was employed as a vector by insertion of the .sup..about.290 bp EcoRI fragment into the unique EcoRI site of the plasmid. EcoRI linearized YEp1PT Small vector was prepared by EcoRI digestion of YEp1PT Small followed by bacterialalkaline phosphatase (BAP) treatment (to prevent religation of the complementary termini). The BAP Was removed by phenol extraction 3.times., chloroform extraction 2.times., and ethanol precipitation. Under standard ligation conditions, the.sup..about.290 bp EcoRI fragment was ligated into the vector.
Competent E. coli 294 prepared according to Dagert and Ehrlich (3) were used as transformation hosts and the transformed culture was plated onto LB-Amp-Agar plates. Several transformants were miniscreened by the Birnboim and Doly procedure (4)and miniscreen plasmid DNAs were digested with HindIII in the appropriate buffer to determine the orientation of the insert. One of several transformants possessing a plasmid with a .sup..about.400 bp HindIII fragment was grown in large scale and itsplasmid was purified. This plasmid was called YEp1PT Small P.I. IGF-1 PGK promoter (see FIG. 14) and was used to transform competent yeast strain 20B-12 (ATCC 200626) (.alpha.trp pep4) cells employing the Hitzeman modification (19) of Hinnen et al.(17), and Beggs et al. (18) procedures.
Several yeast transformants were grown in suspension in identical fashion as were those of the P.I. IGF-1 EcoRI-EcoRI P.I. promoter plasmid transformation and supernates were measured for activity determined by a radioimmune assay method ofFurlanetto et al. (23) as modified by Hintz et al. (24). Shake flask supernates of three transformants contained activities ranging from 38 to 53 ng/ml of supernate. Similarly, one of these transformants was selected and grown in larger scale,utilizing a 10 liter fermenter and the secreted IGF-1 activity in the supernate reached a peak of .sup..about.780 ng/ml. This fermentation supernate was also subjected to a radioreceptor assay (26) and was demonstrated to contain IGF-1 activity.
Stature Human IGF Production
To construct a DNA sequence coding for the .alpha.-factor pre-pro protein fused to the DNA sequence coding for mature IGF-1, and M-13 in vitro mutagenesis technique was employed (See Regin et al., Proc. Acad. Science (USA) 75, 4208; Hutchinson,et al., Journal Biological Chem. 253, 6551; Gilliam, et al., Gene 8, 81 an 99; Gillam, et al., Nucleic Acids Research 6, 2973; Adelman, et al., DNA (June, 1983).)
To construct the M13 plasmid, the plasmid YEp9T .alpha.-factor EcoRI-EcoRI IGF-1 (FIG. 16; SEQ ID NOS. 51-52) was digested with BglII and SalI and the ca. 1.5 Kbp fragment containing the .alpha.-factor promoter-signal fused to IGF-1 wasisolated by polyacrylamide gel electrophoresis. This fragment was then ligated under standard ligation conditions to an MP-8 (BRL) vector digested with B3BamHI and SalI, and treated with bacterial alkaline phosphatase. This ligation mix was thentransformed into competent JM4101 cells prepared according to the method of Dagert and Ehrlich (3). These transformants were then mixed with non-competent JM101 cells grown to log phase, mixed with top agar and plated onto LB agar plates. Several clearplaques W were picked and sequenced using M-13 dideoxy sequencing technique to confirm the presence of an insertion into the SalI-BamHI sites of the vector.
To perform the deletion according to the method above, a single strand of DNA of the sequence. 5' AGAGTTTCCGGACCG CTT TTATCCAAAG 3' SEQ ID NO. 11 was chemically synthesized by standard methods (2) and used to delete the DNA sequence.
TABLE-US-00005 5' GAGGCTGAAGCTCTAGAATTCCCTGCC 3' SEQ ID NO. 12 3' CTCCGACTTCGAGATCTTAAGGGACGG 5' SEQ ID NO. 13
just preceding the IGF-1 coding sequence of the .alpha.-factor promotor/signal IGF-1 fusion sequence. This construction was then isolated as a replicate form, using a large scale plasmid preparation procedure from a JM101 cell cultureinoculated with this plasmid containing the deletion.
The isolated replicate form (10 mg) Was then digested with SalI, phenol-chloroform extracted and then ethanol precipitated and prepared for ligation. To this replicate form was ligated Sal I-EcoRI linkers. After ligation and inactivation of theligase by phenol, chloroform extraction followed by ethanol precipitation, the material was digested with .sup..about.50 U EcoRI enzyme under standard conditions and then run onto a 6 percent polyacrylamide gel. The ca. 1.5 khp RI-EcoRI fragmentreleased was isolated from the gel and prepared for ligation using standard conditions.
Yeast vector was prepared by digestion of 10 mg YEP9T plasmid with 50 units of EcoRI followed by treatment with bacteral alkaline phosphatase. The digestion was then repeatedly phenol-chloroform extracted and then ethanol precipitated andprepared for ligation.
The ca. 1.5 kbp EcoRI-EcoRI fragment containing the deletion was then ligated to the EcoRI-EcoRI YEP9t vector and the ligation mix was then transferred into competent 294 cells prepared according to the method of Dagert and Erhlich (3) andminiscreened using the method of Birnboin and Doly (4). DNA prepared was screened by digestion with EcoRI and those DNAs illustrating an insertion of the ca. 1.5 kbp fragment were used to transform competent yeast strain 20B-12 (ATCC 2026) according tothe modification of Ilitzerman (19) of the Hinner, et al., (17), and Beggs, et al., (18) procedures.
Transformants were then grown in shaker flasks and supernates assayed and shown to have IGF-1 activity by the radioimmune assay procedure of Furlanetto. et al., (23) as modified by Hintz, et al., (24).
One of these clones was grown in large scale in a 10-liter fermentor and IGF-1 purified from the supernatant of this fermentation. This material was then subjected to amino terminal protein sequencing and shown to be mature IGF-1 protein.
Human EGF is prepared in accordance with the invention following analogous procedures as those described above. Construction, Expression, and Secretion of Human EGF.
In a fashion similar to IGF-1, double stranded DNA (FIG. 15; SEQ ID NO. 50) synthesized either by chemical means or through polymerization reactions was assembled to form a mature EGF coding sequence, with a codon coding for methionine (ATG) justpreceding the amino-terminal asparagine found in the mature protein, and a codon (GTC) substituting valine for methionine at residue number 21 from the amino terminal asparagine. This construction was then attached at the 5' end to an additional codingsequence, which when expressed in yeast or bacteria produced a fusion protein. This fusion protein was then susceptible to CNBr cleavage at the methionine to release the valine substituted human EGF molecule.
To secrete the mature form of EGF from yeast, the above sequence coding for the mature protein was attached to the .alpha.-factor promoter/prepro sequence, the codon coding for valine at residue number 21 was replaced by ATG, and the appropriatedeletion was made to bring the coding sequence for mature EGF adjacent to the .alpha.-factor signal coding sequence (FIG. 16; SEQ ID NOS. 51-52). This construction was then inserted into the yeast vector Yep9T and transformed into yeast. Transformantsproduced as such expressed and secreted mature human EGF. In addition, the sequence coding for mature EGF was attached to the preinvertase signal sequence (FIG. 17; SEQ ID NOS. 53-54) and this construction, when inserted into the yeast vector Yep1PTSmall containing the PGK promoter, and transformed into yeast, resulted in the expression and secretion of human EGF.
Construction, Expression, and Secretion of Human IGF-II
A double stranded DNA sequence coding for mature IGF-II was constructed from a combination of synthetic and natural DNA sequences (FIG. 18; SEQ ID NOS. 55-56). This coding sequence, which did not contain an internal methionine, was attached tothe TrpE leader protein coding sequence and was expressed as a fusion protein. Mature IGF-II was chemically cleaved from the purified fusion product by the action of CNBr upon a methionine residue preceding the first residue (alanine) of the matureprotein.
The IGF-II coding sequence was also attached to the .alpha.-factor promoter/prepro sequence and after the appropriate deletion was made to bring the 3' end of the .alpha.-factor signal coding sequence adjacent to the 5' end of mature IGF-IIcoding sequence, the construction was inserted into the Yep9T vector and transformed into yeast. Resultant transformants expressed and secreted mature human IGF-II. In the same manner, the sequence coding for mature IGF-II was attached to thepreinvertase coding sequence. The resultant construction was inserted into Yep1PT Small and transformed into yeast. Transformants produced as such expressed and secreted mature human IGF-II.
Pharmaceutical Compositions
The compounds of the present invention can be formulated according to known methods to prepare pharmaceutically useful compositions, whereby the human IGF and human EGF or products hereof are combined in admixture with a pharmaceuticallyacceptable carrier vehicle. Suitable vehicles and their formulation, inclusive of other human proteins, e.g. human serum albumin are described, for example, in Remington's Pharmaceutical Sciences by E. W. Martin, which is hereby incorporated byreference. Such compositions will contain an effective amount of the protein hereof together with a suitable amount of vehicle in order to prepare pharmaceutically acceptable compositions suitable for effective administration.
Notwithstanding that reference has been made to particular preferred embodiments of the present invention, it will be understood that the present invention is not to be construed as limited to such but rather to the lawful scope of the appendedclaims.
Bibliography
A. Rinderknecht, E. W. et al., Proceedings National Academy of Sciences (USA) 73, 2365 (1976). B. Rinderknecht, et al., Proceedings National Academy of Sciences (USA) 73, 4379 (1976). C. Blundell, et al., Proceedings National Academy ofSciences (USA) 75, 1980 (1978). D. Rinderknecht, et al., Journal of Biological Chemistry 253, 2769 (1978), 2365 (1976). E. Rinderknecht, et al., FEBS Letters 89, 283 (1978). F. Zaph, et al., Metabolism 27, 1803 (1978). G. Hintz, et al., Journal ofClinical Endocrinology and Metabolism 50, 405 (1980). H. Blundell, et al., Nature 287, 781 (1980). I. Hintz, et al., Journal of Clinical Endo. and Metabolism 51, 672 (1980). J. Baxter, et al., Journal of Clinical Endo. and Metabolism 54, 464 (1980). K. Hintz, et al., Journal of Clinical Endo, and Metabolism 54, 442 (1982). L. Schoenie, et al., Nature 296, 252 (1982). M. British Patent Application Publication No. 2007676A. N. Wetzel, American Scientist 68, 664 (1980). O. Microbiology, SecondEdition, Harper and Row Publications Inc., Hagerstown, Md. (1973), especially pages 1122 et sequence. P. Scientific American 245, 106 (1981). 1. Rinderknecht, E. and Humbel, R. E., J. Biol. Chem. 253, 8, 2769-2776 (1978). 2. Crea, R. and Horn, T.,Nucleic Acids Research 8, 2331-2776 (1980). 3. Dagert, M. and Ehrlich, S. D., Gene 6, 23-28 (1979). 4. Birnboim, H. C. and Doly, J., Nucleic Acids Research 7, 1513-1523 (1979). 5. Maxam, A. and Gilbert, W. Methods in Enzymology 65, 499 (1980). 6. Villa-Komaroff et al., Proc. Natl. Acad. Sci. USA 75, 3727 (1979). 7. Rowenkamp and Firtel, Dicryostelium Dev. Biol. 79, 409 (1980). 8. Wunsch, E. et al., Hoppe-Seyler's Z. Physiol. Chem. Bd. 362, S1285-1287 (September 1981). 9. Maniatis,T. et al., Molecular Cloning, 426 (1982). 10. Kleid., D. G., New York Acad. of Sci., Annals. (in press) 11. Seifer, S. and Gallop, P. M. The Proteins, 2nd Ed. (H. Neurath, ed.) Vol. V. p. 659 (1966). 12. Nordwig, A., Leder 13, 10 (1962). 13. Lin, N. (U.S. Ser. No. 06/452,363, filed Dec. 22, 1982). 14. Laemmli, U. K. Nature (London) 227, 680-685 (1970). 15. Bolivar, F. et al., Gene 2, 95 (1977). 16. Chang, C. N. (U.S. Ser. No. 06/488337, filed Apr. 25, 1983 filed as a continuationU.S. Ser. No. 07/541,186 on Jun. 20, 1990, and issued as U.S. Pat. No. 5,010,003). 17. Hinnen, A. et al., Proc. Natl. Acad. Sci. USA 75, 1929-1933 (1978) 18. Beggs, J. D., Nature 275, 104-109 (1978). 19. Hitzeman, R. A. et al. U.S. Ser. No. 438236, filed Nov. 1, 1982 20. Capon, D. (refer to Bovine Interferon patent number) (1983). 21. Hitzeman, R. A. et al., Science 219, 620-625 (1983). 22. Singh, A. (U.S. Ser. No. 06/488323, filed Apr. 25, 1983). 23. Furlanetto, R. W.,Underwood, L. E., Van Wyk, J. J., D'Ercole, A. J., J. Clin. Invest. 60, 648 (1977). 24. Hintz, R. L., Liu, F., Marshall, L. B., Chung, D., J. Clin. Endocrinol. Metab. 50, 405 (1980). 25. Hitzeman, R. A. et al., Proceedings of the Berkeley Workshopon Recent Advances in Yeast Molecular Biology: Recombinant DNA U.C. Press, Berkeley, p. 173 (1982). 26. Horner, J. M., Liu, F., Hintz, R. A., J. Clin. Endocrinol. Metab. 47, 6, p. 1287 (1978). 27. Rossi, J. J. Zierzek, R., Huang, T., Walker, P. A.,Itakura, K., J. Biol. Chem. 257, 16, 9226 (1982).
>
66rtificial SequenceSynthetic DNA gaat tc AArtificial SequenceSynthetic DNA 2gatcgaattc tg AArtificial Sequence5' ProAla DNA linker; syntheticDNA 3aattccctgc cg AArtificial Sequence3' ProAla DNA linker; synthetic DNA 4gaccggcagg g AArtificial Sequence5' SalI-EcoRI DNA linker; synthetic DNA 5tcgacgtaca tg AArtificial Sequence3' SalI-EcoRI DNA linker; synthetic DNA6aattcatgta cg AArtificial Sequence5' synthetic DNA; yeast invertase coding signal 7agctttcctt ttccttttgg c 2Artificial Sequence3' synthetic DNA; yeast invertase coding signal 8aaccagccaa aaggaaaagg aa 22926DNAArtificial Sequence5'synthetic DNA; yeast invertase coding signal 9tggttttgca gccaaaatat ctgcag 26Artificial Sequence3' synthetic DNA; yeast invertase coding signal gcaga tattttggct gcaa 24Artificial SequenceSynthetic DNA ttccg gacctctttt atccaaag28Artificial Sequence5' Synthetic DNA; isolated replicative form tgaag ctctagaatt ccctgcc 27Artificial Sequence3' Synthetic DNA; isolated replicative form ggaat tctagagctt cagcctc 27Artificial SequenceDNA IGF-Half mer); Synthetic DNA tgatt tcgaattcta tgggtccgga aactctgtgc ggc 43Artificial SequenceDNA IGF-Half 3L (43-mer); Synthetic DNA tgatt ctgcagagcg tcaaccagct cagcgccgca cag 43Artificial SequenceDNA IGF-Half2L (46-mer); Synthetic DNA tgatt ctgcagttcg tatgtggtga tcgaggcttc tacttc 46Artificial SequenceDNA IGF-Half 4L (46-mer); Synthetic DNA tgatt gaggatccgt acccagtcgg tttgttgaag tagaag 46Artificial SequenceDNA IGF-Half mer); Synthetic DNA acttc tggatcctcc tctcgtcgtg ctccgcaaac cggcat 46Artificial SequenceDNA IGF- Half 3R (46-mer); Synthetic DNA actta caggaccgaa aacagcattc atcaacgatg ccggtt 462rtificial SequenceDNA IGF- Half 2R (54-mer); Synthetic DNA 2actt ggtcctgtga ccttcgccgt ctggaaatgt actgcgctcc gctg 542rtificial SequenceDNA IGF- Half 4R (46-mer); Synthetic DNA 2cttg agtcgactat gcagacttag ccggtttcag cggagc 4622tificialSequenceProtein IGF-Half Part hetic Protein 22Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln NAArtificial SequenceDNA IGF-Half Part hetic DNA 23agttctgatt tcgaattcta tgggtccgga aactctgtgc ggcgctgagctggttgacgc 6gaat cagaact 7724tificial SequenceProtein IGF-Half Part 2; Synthetic Protein 24Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly ly2582DNAArtificial SequenceDNA IGF-Half Part 2;Synthetic DNA 25agttctgatt ctgcagttcg tatgtggtga tcgaggcttc tacttcaaca aaccgactgg 6atcc tcaatcagaa ct 8226tificial SequenceProtein IGF- Half Part 3; Synthetic Protein 26Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cysrg Ser2783DNAArtificial SequenceDNA IGF- Half Part 3; Synthetic DNA 27gactgacttc tggatcctcc tctcgtcgtg ctccgcaaac cggcatcgtt gatgaatgct 6ggtc ctgtaagtca gtc 83282ificial SequenceProtein IGF- Half Part 4;Synthetic Protein 28Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro Leu Lys Pro ys Ser Ala 2AArtificial SequenceDNA IGF- Half Part 4; Synthetic DNA 29tgactgactt ggtcctgtga ccttcgccgt ctggaaatgt actgcgctcc gctgaaaccg6tctg catagtcgac tcaagtcagt c 9TArtificial SequenceProtein IGF-Half Part hetic Protein 3o Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln NAArtificial SequenceDNA IGF-Half Part SyntheticDNA 3atgg gtccggaaac tctgtgcggc gctgagctgg ttgacgctct gcag 543246DNAArtificial SequenceDNA IGF-Half Part Synthetic DNA 32gatacccagg cctttgagac acgccgcgac tcgaccaact gcgaga 4633tificial SequenceProtein IGF-Half Part 2;Synthetic Protein 33Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr NAArtificial SequenceDNA IGF-Half Part 2; 2L; Synthetic DNA 34ttcgtatgtg gtgatcgagg cttctacttc aacaaaccga ctgggtac 483557DNAArtificial SequenceDNAIGF-Half Part 2; 4L; Synthetic DNA 35cgtcaagcat acaccactag ctccgaagat gaagttgttt ggctgaccca tgcctag 5736tificial SequenceProtein IGF- Half Part 3; Synthetic Protein 36Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cys rg Ser3799DNAArtificial SequenceDNA IGF- Half Part 3; Synthetic DNA 37gactgacttc tggatcctcc tctcgtcgtg ctccgcaaac cggcatcgtt gatgaatgct 6ggtc ctgtaagtca gtcccccccc ccccccccc 993898DNAArtificial SequenceDNA IGF- Half Part3; Synthetic DNA 38cccccccccc cccccctgac tgaagaccta ggaggagagc agcacgaggc gtttggccgt 6tact tacgacaaaa gccaggacat tcagtcag 98392ificial SequenceProtein IGF- Half Part 4; Synthetic Protein 39Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr CysAla Pro Leu Lys Pro ys Ser Ala Thr 2NAArtificial SequenceDNA IGF- Half Part 4; Synthetic DNA 4actt ggtcctgtga ccttcgccgt ctggaaatgt actgcgctcc gctgaaaccg 6tctg catagtcgac tcaagtcagt cccccccccc ccccccc6DNAArtificial SequenceDNA IGF- Half Part 4; Synthetic DNA 4cccc cccccactga ctgaaccagg acactggaag cggcagacct ttacatgacg 6gact ttggccgatt cagacgtatc agctgagttc agtcag 2PRTArtificial SequenceDeduced fusion proteincontaining IGF-hetic protein 42Met Lys Ala Ile Phe Val Leu Lys Gly Ser Leu Asp Arg Asp Leu Asp rg Ile Glu Leu Glu Met Arg Thr Asp His Lys Glu Leu Ser Glu 2His Leu Met Leu Val Asp Leu Ala Arg Asn Asp Leu Ala Arg Ile Cys 35 4 Pro Gly Ser Arg Tyr Val Ala Asp Leu Thr Lys Val Asp Arg Tyr 5Ser Tyr Val Met His Leu Val Ser Arg Val Val Gly Glu Leu Arg His65 7Asp Leu Asp Ala Leu His Ala Tyr Arg Ala Cys Met Asn Met Gly Thr 85 9 Ser Gly Ala Pro Lys Val ArgAla Met Gln Leu Ile Ala Glu Ala Gly Arg Arg Arg Gly Ser Tyr Gly Gly Ala Val Gly Tyr Phe Thr His Gly Asp Leu Asp Thr Cys Ile Val Ile Arg Ser Ala Leu Val Asn Gly Ile Ala Thr Val Gln Ala Gly Ala Gly Val Val LeuAsp Ser Val Pro Gln Ser Glu Ala Asp Glu Thr Arg Asn Lys Ala Arg Ala Leu Arg Ala Ile Ala Thr Ala His His Ala Gln Glu Phe Pro Ala Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Gln Phe 2ys GlyAsp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr Gly 222r Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cys225 234g Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro Leu 245 25s Pro Ala Lys Ser Ala26NAArtificial SequenceSynthetic DNA 43atgaaagcaa ttttcgtact gaaaggttca ctggacagag atctcgacag ccgtattgaa 6atgc gtaccgatca taaagagctg tctgaacatc tgatgctggt tgatctcgcc atgatc tggcacgcat ttgcaccccc ggcagccgct acgtcgccga tctcaccaaaaccgtt attcctatgt gatgcacctc gtctctcgcg tagtcggcga actgcgtcac 24gacg ccctgcacgc ttatcgcgcc tgtatgaata tggggacgtt aagcggtgcg 3agtac gcgctatgca gttaattgcc gaggcggaag gtcgtcgccg cggcagctac 36gcgg taggttattt caccgcgcat ggcgatctcgacacctgcat tgtgatccgc 42ctgg tggaaaacgg tatcgccacc gtgcaagcgg gtgctggtgt agtccttgat 48ccgc agtcggaagc cgacgaaacc cgtaacaaag cccgcgctgt actgcgcgct 54accg cgcatcatgc acaggaattc cctgccggtc cggaaactct gtgcggcgct 6ggttg acgctctgcagttcgtatgt ggtgatcgag gcttctactt caacaaaccg 66tacg gatcctcctc tcgtcgtgct ccgcaaaccg gcatcgttga tgaatgctgt 72tcct gtgaccttcg ccgtctggaa atgtactgcg ctccgctgaa accggctaag 78tagt cgacgtacat gaa 8RTArtificial SequencesLE-IGF-n Protein; synthetic Protein 44Met Lys Ala Ile Phe Val Leu Lys Gly Ser Leu Asp Arg Asp Pro Glu ro Ala Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala 2Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr 35 4 Tyr Gly Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp 5Glu Cys Cys Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys65 7Ala Pro Leu Lys Pro Ala Lys Ser Ala 854527ificial SequenceSynthetic DNA 45atgaaagcaa ttttcgtactgaaaggttca ctggacagag atccagaatt ccctgccggt 6actc tgtgcggcgc tgagctggtt gacgctctgc agttcgtatg tggtgatcga tctact tcaacaaacc gactgggtac ggatcctcct ctcgtcgtgc tccgcaaacc tcgttg atgaatgctg ttttcggtcc tgtgaccttc gccgtctgga aatgtactgc24ctga aaccggctaa gtctgcatag 27RTArtificial SequenceIGF-in fused with alpha factor pre-pro sequence; synthetic protein 46Met Arg Phe Pro Ser Ile Phe Ser Ala Val Leu Phe Ala Ala Ser Ser eu Ala Ala Pro Val Asn Thr Thr ThrGlu Asp Glu Thr Ala Gln 2Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 4 Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 5Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val65 7SerLeu Asp Lys Arg Glu Ala Glu Ala Leu Glu Phe Pro Ala Gly Pro 85 9 Thr Leu Cys Gly Ala Glu Leu Val Asp Ala Leu Glu Phe Val Cys Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr Gly Tyr Gly Ser Ser Arg Arg Ala Pro Gln Thr Gly IleVal Asp Glu Cys Cys Phe Arg Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro Leu Lys Pro Ala Lys Ser Ala47495DNAArtificial SequenceSynthetic DNA 47atgagatttc cttcaatttt tagtgcagtt ttattcgcag catcctccgc attagctgct 6aacactacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt cagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat ggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 24gata aaagagaggc tgaagctcta gaattccctg ccggtccggaaactctgtgc 3tgaac tggttgacgc tctggagttc gtatgtggtg accgtggctt ttacttcaac 36actg gttacggatc ctcctctcgt cgcgctccgc aaactggcat cgttgatgaa 42tttc gttcttgtga cctgcgccgt ctggaaatgt actgcgctcc gctgaaaccg 48tctg catag4954889PRTArtificial SequenceYeast invertase signal IGF-n protein 48Met Leu Leu Gln Ala Phe Leu Phe Leu Leu Ala Gly Phe Ala Ala Lys er Ala Gly Pro Glu Thr Leu Cys Gly Ala Glu Leu Val Asp Ala 2Leu Gln Phe Val Cys Gly Asp ArgGly Phe Tyr Phe Asn Lys Pro Thr 35 4 Tyr Gly Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp 5Glu Cys Cys Phe Arg Ser Cys Asp Leu Arg Arg Leu Glu Met Tyr Cys65 7Ala Pro Leu Lys Pro Ala Lys Ser Ala 854927ificialSequenceSynthetic DNA 49atgcttttgc aagctttcct tttccttttg gctggttttg cagccaaaat atctgcaggt 6actc tgtgcggcgc tgagctggtt gacgctctgc agttcgtatg tggtgatcga tctact tcaacaaacc gactgggtac ggatcctcct ctcgtcgtgc tccgcaaacc tcgttg atgaatgctgttttcggtcc tgtgaccttc gccgtctgga aatgtactgc 24ctga aaccggctaa gtctgcatag 27NAArtificial SequenceSynthetic DNA; mature EGF coding sequence 5atga actctgactc tgaatgtcca ttatcgcatg atgggtactg tttgcacgac 6tgta tgtatattga agctctagacaagtacgctt gtaactgtgt tgttggttac gtgaaa gatgtcaata cagagatcta aagtggtggg aattgagata gattgaattg gaaatc gattaaagct t 2PRTArtificial SequenceYeast alpha factor protein "pre-pro" sequence fused with EGF 5g Phe Pro Ser Ile Phe SerAla Val Leu Phe Ala Ala Ser Ser eu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 2Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 4 Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 5Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val65 7Ser Leu Asp Lys Arg Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp 85 9 Tyr Cys Leu His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Tyr Ala Cys Asn Cys Val ValGly Tyr Ile Gly Glu Arg Cys Gln Arg Asp Leu Lys Trp Trp Glu Leu Arg 524tificial SequenceEGF DNA fused with yeast alpha factor "pre-pro" sequence 52atgagatttc cttcaatttt tagtgcagtt ttattcgcag catcctccgc attagctgct 6aacactacaacaga agatgaaacg gcacaaattc cggctgaagc tgtcatcggt cagatt tagaagggga tttcgatgtt gctgttttgc cattttccaa cagcacaaat ggttat tgtttataaa tactactatt gccagcattg ctgctaaaga agaaggggta 24gata aaagaaactc tgactctgaa tgtccattat cgcatgatgggtactgtttg 3cggag tctgtatgta tattgaagct ctagacaagt acgcttgtaa ctgtgttgtt 36atcg gtgaaagatg tcaatacaga gatctaaagt ggtgggaatt gagatag 4RTArtificial SequenceYeast invertase signal protein sequence fused with EGF 53Met Leu Leu Gln AlaPhe Leu Phe Leu Leu Ala Gly Phe Ala Ala Lys er Ala Asn Ser Asp Ser Glu Cys Pro Leu Ser His Asp Gly Tyr 2Cys Leu His Asp Gly Val Cys Met Tyr Ile Glu Ala Leu Asp Lys Tyr 35 4 Cys Asn Cys Val Val Gly Tyr Ile Gly Glu Arg Cys GlnTyr Arg 5Asp Leu Lys Trp Trp Glu Leu Arg65 7NAArtificial SequenceEGF DNA fused with invertase sequence 54gaattcatga tgttgttgca agctttcttg ttcttgttgg ctggtttcgc tgctaagatc 6aact ctgactctga atgtccatta tcgcatgatg ggtactgttt gcacgacggagtatgt acattgaagc tctagacaag tacgcttgta actgtgttgt tggttacatc aaagat gtcaatacag agatctaaag tggtgggaat tgagatagat tgaattgaat 24cgat taaagctt 2585568PRTArtificial SequenceProtein coding sequence for Human IGF-II 55Met Ala Tyr Arg ProSer Glu Thr Leu Cys Gly Gly Glu Leu Val Asp eu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro 2Ala Ser Arg Val Ser Arg Arg Ser Arg Gly Ile Val Glu Glu Cys Cys 35 4 Arg Ser Cys Asp Leu Ala Leu Leu Glu Thr Tyr Cys AlaThr Pro 5Ala Lys Ser Glu655622ificial SequenceDNA coding sequence for Human IGF-II 56tctagaatta tggcttatcg accatctgaa accttgtgtg gtggtgagct ggtggacacc 6ttcg tctgtgggga ccgcggtttc
tacttctcta ggcccgcaag ccgtgtgagc gcagtc gtggcatcgt tgaggagtgc tgtttccgca gctgtgacct ggccctattg cctact gtgctacccc agctaagtct gaataggatc c 22Artificial SequenceProtein carboxy terminus of alpha factor 57Gly Gln Pro Met Tyr DNAArtificial Sequencemisc_feature3U= T or C 58ggucaaccua tgtac NAArtificial Sequencemisc_featureor G 59gtacattggt tgucc NAArtificial Sequencemisc_featureor G 6aggt tgucc DNAArtificial SequenceDNA sequenceof alpha factor 6taaa ttttgccgaa tttaatagct tctactgaaa aacagtggac catgtgaaaa 6tctc atttatcaaa cacataatat tcaagtgagc cttacttcaa ttgtattgaa aagaaa accaaaaagc aacaacaggt tttggataag tacatatata agagggcctt tcccat caaaaatgttactgttctta cgattcattt acgattcaag aatagttcaa 24agat tacaaactat caatttcata cacaatataa acgattaaaa gaatgagatt 3caatt tttactgcag ttttattcgc agcatcctcc gcattagctg ctccagtcaa 36aaca gaagatgaaa cggcacaaat tccggctgaa gctgtcatcg gttacttaga42aggg gatttcgatg ttgctgtttt gccattttcc aacagcacaa ataacgggtt 48tata aatactacta ttgccagcat tgctgctaaa gaagaagggg tatctttgga 54agag 55TArtificial SequenceProtein sequence of alpha factor 62Phe Thr Ala Val Leu Phe Ala Ala SerSer Ala Leu Ala Ala Pro Val hr Thr Thr Glu Asp Glu Thr Ala Gln Ile Pro Ala Glu Ala Val 2Ile Gly Tyr Leu Asp Leu Glu Gly Asp Phe Asp Val Ala Val Leu Pro 35 4 Ser Asn Ser Thr Asn Asn Gly Leu Leu Phe Ile Asn Thr Thr Ile 5Ala Ser Ile Ala Ala Lys Glu Glu Gly Val Ser Leu Asp Lys Arg Glu65 76379PRTArtificial SequenceProtein sequence of alpha factor 63Ala Glu Ala Trp His Trp Leu Gln Leu Lys Pro Gly Gln Pro Met Tyr rg Glu Ala Glu Ala Glu Ala Trp His TrpLeu Gln Leu Lys Pro 2Gly Gln Pro Met Tyr Lys Arg Glu Ala Asp Ala Glu Ala Trp His Trp 35 4 Gln Leu Lys Pro Gly Gln Pro Met Tyr Lys Arg Glu Ala Asp Ala 5Glu Ala Trp His Trp Leu Gln Leu Lys Pro Gly Gln Pro Met Tyr65 752DNAArtificial SequenceDNA sequence of alpha factor 64gctgaagctt ggcattggtt gcaactaaaa cctggccaac caatgtacaa gagagaagcc 6gaag cttggcattg gctgcaacta aagcctggcc aaccaatgta caaaagagaa acgctg aagcttggca ttggctgcaa ctaaagcctg gccaaccaatgtacaaaaga ccgacg ctgaagcttg gcattggttg cagttaaaac ccggccaacc aatgtactaa 24ctga taacaacagt gtagatgtaa caaagtcgac tttgttccca ctgtactttt 3gtaca aaatacaata tacttttcat ttctccgtaa acaacatgtt ttcccatgta 36tttt ctatttttcg ttccgttaccaactttacac atactttata tagctattca 42taca ctaaaaaact aagacaattt taattttgct gcctgccata tttcaatttg 48attc ctataattta tcctattagt agctaaaaaa agatgaatgt gaatcgaatc 54gaat tc 55265967DNAArtificial SequenceDNA sequence of alpha factor65ttcttcattg gtacatcaat gccagcaacg atgtgcgcat ctgggcgacg cctgtagtga 6tcaa ggtatcgagc caaactattc atcgttactg tttcaaatat tcagttgttt acagag tcgccgtgga cctagtgaaa cttggtgtct ttacagcgca gagacgaggg tatgta taaaagctgt ccttgattct ggtgtagtttgaggtgtcct tcctatatct 24atat tctatataat ggataattac taccatcacc tgcatcaaat tccagtaaat 3tattg gagaaaatga aattcatttc tacctttctc acttttattt tagcggccgt 36cact gctagttccg atgaagatat cgctcaggtg ccagccgagg ccattattgg 42ggat ttcggaggtgatcatgacat agctttttta ccattcagta acgctaccgc 48gcta ttgtttatca acaccactat tgctgaggcg gctgaaaaag agcaaaacac 54ggcg aaaagagagg ctgttgccga cgcttggcac tggttaaatt tgagaccagg 6caatg tacaagagag aggccaacgc tgatgcttgg cactggttgc aactcaagcc66acca atgtactgaa aaatgaccct aaactacttc taaaccctct cgatttcttt 72cata caacacctag ttttatttat tttcttttca atctgagtag ttgagttttc 78tcac atagaactat tttttgccat ttaaataaag tattctctca aatgatgcga 84aata ctctttgcca tatattacat tcattcataaataggctatg tttctatatc 9ccgat tctgtctgca agcaaggttc cctatcatta ccggattgtt cactatggtt 96c 96766rtificial SequenceProtein sequence of alpha factor 66Met Lys Phe Ile Ser Thr Phe Leu Thr Phe Ile Leu Ala Ala Val Ser hr AlaSer Ser Asp Glu Asp Ile Ala Gln Val Pro Ala Glu Ala 2Ile Ile Gly Tyr Leu Asp Phe Gly Gly Asp His Asp Ile Ala Phe Leu 35 4 Phe Ser Asn Ala Thr Ala Ser Gly Leu Leu Phe Ile Asn Thr Thr 5Ile Ala Glu Ala Ala Glu Lys Glu Gln Asn Thr ThrLeu Ala Lys Arg65 7Glu Ala Val Ala Asp Ala Trp His Trp Leu Asn Leu Arg Pro Gly Gln 85 9 Met Tyr Lys Arg Glu Ala Asn Ala Asp Ala Trp His Trp Leu Gln Lys Pro Gly Gln Pro Met Tyr
* * * * * |
|
|
|