Resources Contact Us Home
Browse by: INVENTOR PATENT HOLDER PATENT NUMBER DATE
 
 
RNA binding protein and binding site useful for expression of recombinant molecules
RE39350 RNA binding protein and binding site useful for expression of recombinant molecules

Patent Drawings:
Inventor: Mayfield
Date Issued: October 17, 2006
Application: 10/310,587
Filed: January 16, 1998
Inventors: Mayfield; Stephen P. (Cardiff, CA)
Assignee: The Scripps Research Institute (La Jolla, CA)
Primary Examiner: Ketter; James
Assistant Examiner:
Attorney Or Agent: Woodcock Washburn, LLP
U.S. Class: 435/6; 435/320.1; 435/375; 435/419; 435/468; 435/69.1; 536/23.1
Field Of Search: 435/6; 435/320.1; 435/419; 435/69.1; 435/375; 435/468; 536/23.1
International Class: C12Q 1/68
U.S Patent Documents: 5693507
Foreign Patent Documents:
Other References: During et al., Plant Molecular Biology, vol. 15 (1990), pp. 281-293. cited by examiner.
Danon et al., EMBO J., vol. 10, 1991, pp. 3993-4001. cited by examiner.
Danon et al., EMBO J., vol. 13, 1994, pp. 2227-2235. cited by examiner.

Abstract: The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.
Claim: What is claimed is:

1. An expression cassette for expression of a desired molecule, which cassette comprises: a) an RB47 binding site nucleotide sequence upstream of a restriction endonucleasesite for insertion of a desired coding sequence to be expressed; and b) a nucleotide sequence encoding a polypeptide which binds RB47 binding site.

2. The expression cassette of claim 1 further comprising a promoter sequence operably linked to and positioned upstream of the RB47 binding site nucleotide sequence.

3. The expression cassette of claim 2 wherein the promoter sequence is derived from a psbA gene.

4. The expression cassette of claim 3 wherein the coding sequence is heterologous to the psbA gene.

5. The expression cassette of claim 1 wherein the cassette comprises a plasmid or virus.

6. The expression cassette of claim 1 further comprising and operably linked thereto a nucleotide sequence encoding RB60.

7. The expression cassette of claim 1 wherein the RB47 binding polypeptide is selected from the group consisting of RB47, RB47 precursor and a histidine-modified RB47.

8. An expression cassette for expression of a desired molecule, which cassette comprises: a) an RB47 binding site nucleotide sequence upstream of a restriction endonuclease site for insertion of a desired coding sequence to be expressed, and b)a nucleotide sequence encoding a polypeptide which regulates the binding of RB47 to the RB47 binding site.

9. The expression cassette of claim 8 wherein the regulatory polypeptide is RB60.

10. A method of screening for agonists or antagonists of RB47 binding to RB47 binding site, the method comprising the steps: a) providing a cell expression system containing 1) a promoter sequence, 2) a RB47 binding site sequence; 3) a codingsequence for an indicator polypeptide; and 4) a polypeptide which binds to the RB47 binding site sequence; b) introducing an antagonist or agonist into the cell; and c) detecting the amount of indicator polypeptide expressed in the cell.

11. A method of screening for agonists or antagonists of RB60 in regulating RB47 binding to RB47 binding site, the method comprising the steps: a) providing an expression system in a cell containing: 1) a promoter sequence; 2) a RB47 bindingsite sequence; 3) a coding sequence for an indicator polypeptide; 4) a polypeptide which binds to the RB47 binding site sequence, and 5) a RB60 polypeptide; b) introducing an agonist or antagonist into the cell; and c) detecting the amount ofindicator polypeptide expressed in the cell.

12. An isolated nucleotide sequence encoding RB47.

13. An isolated nucleotide sequence encoding a histidine-modified RB47.

14. An isolated nucleotide sequence encoding RB47 precursor.

15. The nucleotide sequence of claim 12 from nucleotide position 197 to 1402 in FIGS. 1A-1B and SEQ ID NO 5.

16. The nucleotide sequence of claim 13 from nucleotide position 1 to 1269 in FIGS. 5A-5B and SEQ ID NO 14.

17. The nucleotide sequence of claim 14 shown in from nucleotide position 197 to 2065 in FIGS. 1A-1C and SEQ ID NO 5.

18. An expression cassette comprising the nucleotide sequence of claim 12, 13 or 14.

19. An isolated nucleotide sequence encoding RB60.

20. The nucleotide sequence of claim 18 from nucleotide position 16 to 1614 in FIGS. 2A-2B and SEQ ID NO 10.

21. An expression cassette comprising the nucleotide sequence of claim 19.

22. An expression system comprising a cell transformed with the expression cassette of claim 1.

23. The expression system of claim 22 wherein the cell is a plant cell.

24. The expression system of claim 23 wherein the plant cell endogenously expresses RB47.

25. The expression system of claim 23 wherein the plant cell endogenously expresses RB60.

26. The expression system of claim 23 wherein the plant cell endogenously expresses RB47 and RB60.

27. The expression system of claim 22 wherein the cell is a eukaryotic cell.

28. The expression system of claim 22 wherein the cell is a prokaryotic cell.

29. The expression system of claim 22 further comprising the an expression cassette of claim 21 comprising an isolated nucleotide sequence encoding RB60.

30. An expression system comprising a cell transformed with the expression cassette of claim 8.

31. The expression system of claim 29 further comprising the an expression cassette of claim 18 comprising an isolated nucleotide sequence encoding RB47, a histidine-modified RB47, or RB47 precursor.

32. A cell stably transformed with the expression cassette of claim 18.

33. A cell stably transformed with the expression cassette of claim 21.

34. A cell stably transformed with the an expression cassette of claims 18 and 21 comprising an isolated nucleotide sequence encoding RB47, histidine-modified RB47, RB47 precursor, or RB60.

35. The expression cassette of claim 1 further comprising an inserted desired coding sequence.

36. An expression system comprising a cell transformed with the expression cassette of claim 35, wherein the coding sequence is expressed forming the desired molecule upon activation of the RB47 binding site with RB47.

37. The expression system of claim 36 wherein the cell is a plant cell endogenously expressing RB47.

38. The expression system of claim 36 wherein the cell is stably transformed with the an expression cassette of claim 21 comprising an isolated nucleotide sequence encoding RB60.

39. An expression system comprising a cell transformed with an expression cassette comprising a promoter sequence, a RB47 binding site sequence, a desired coding sequence for a molecule, and a nucleotide sequence for encoding a polypeptidewhich binds RB47 binding site, wherein all sequences are operably linked.

40. A method of preparing a desired recombinant molecule wherein the method comprises cultivating the expression system of claim 36.

41. A method of preparing a desired recombinant molecule wherein the method comprises cultivating the expression system of claim 39.

42. A method for expressing a desired coding sequence comprising: a) forming an expression cassette by operably linking: 1) a promoter sequence; 2) a RB47 binding site sequence; 3) a desired coding sequence; and 4) a nucleotide sequenceencoding a polypeptide which binds RB47 binding site, and b) introducing the expression cassette into a cell.

43. The method of claim 42 wherein the cell is a plant cell endogenously expressing RB47.

44. The method of claim 42 wherein the cell is a plant cell endogenously expressing RB60.

45. The method of claim 42 further comprising inducing expression with a promoter inducer molecule.

46. The method of claim 45 wherein the promoter inducer molecule is IPTG.

47. The method of claim 42 wherein the cell is transformed with the an expression cassette of claim 21 comprising an isolated nucleotide sequence encoding RB60.

48. A method for expressing a desired coding sequence comprising: a) forming an expression cassette by operably linking: 1) a promoter sequence; 2) a RB47 binding site sequence; and 3) a desired coding sequence; and b) introducing theexpression cassette into a plant cell endogenously expressing RB47.

49. The method of claim 48 wherein the expression cassette further comprises a nucleotide sequence encoding RB60.

50. A method for the regulated production of a recombinant molecule from a desired coding sequence in a cell, wherein the cell contains the expression cassette of claim 34, wherein expression of the coding sequence is activated by RB47 bindingto the RB47 binding site thereby producing the recombinant molecule.

51. A method of forming an expression cassette by operably linking: a) a RB47 binding site sequence; b) a cloning site for insertion of a desired coding sequence downstream of the RB47 binding site sequence; and c) a nucleotide sequenceencoding a polypeptide which binds the RB47 binding site.

52. The method of claim 51 further comprising a promoter sequence operably linked upstream to the RB47 binding site sequence.

53. The method of claim 51 further comprising a desired coding sequence inserted into the insertion site.

54. An article of manufacture comprising a packaging material and contained therein in a separate container the expression cassette of claim 1, wherein the expression cassette is useful for expression of a desired coding sequence, and whereinthe packaging material comprises a label which indicates that the expression cassette can be used for expressing a desired coding sequence when the RB47 binding is activated by RB47.

55. The article of manufacture of claim 54 further comprising in a separate container the an expression cassette of claim 18 comprising an isolated nucleotide sequence encoding RB47, a histidine-modified RB47, or RB47 precursor.

56. The article of manufacture of claim 54 further comprising in a separate container the an expression cassette of claim 21 comprising an isolated nucleotide sequence encoding RB60.

57. An article of manufacture comprising a packaging material and contained therein in a separate container the expression system of claim 22, wherein the expression system is useful for expression of a desired coding sequence, and wherein thepackaging material comprises a label which indicates that the expression system can be used for expressing a desired coding sequence when the RB47 binding site is activated by RB47.

58. An article of manufacture comprising a packaging material and contained therein in a separate container the stably transformed cell of claim 32, wherein the cell is useful as an expression system, and wherein the packaging materialcomprises a label which indicates that the expression system can be used for expressing a desired coding sequence when the RB47 binding site is activated by RB47.

59. An article of manufacture comprising a packaging material and contained therein in a separate container the stably transformed cell of claim 33, wherein the cell is useful as an expression system, and wherein the packaging materialcomprises a label which indicates that the expression system can be used for expressing a desired coding sequence when the RB47 binding site is activated by RB47 and regulated by RB60.

60. An article of manufacture comprising a packaging material and contained therein in a separate container the stably transformed cell of claim 34, wherein the cell is useful as an expression system, and wherein the packaging materialcomprises a label which indicates that the expression system can be used for expressing a desired coding sequence when the RB47 binding site is activated by RB47 and regulated by RB60.

61. An article of manufacture comprising a packaging material and contained therein in a separate container the expression cassette of claim 2, wherein the expression cassette is useful for expression of a RNA transcript, and wherein thepackaging material comprises a label which indicates that the expression cassette can be used for producing in vitro a RNA transcript when the RB47 binding site is activated by RB47.

62. The article of manufacture of claim 61 wherein the promoter sequence is selected from the group consisting of T3 and T7 promoters.

63. The article of manufacture of claim 61 further comprising in separate containers a polymerase, a buffer and each of four ribonucleotides, reagents for in vitro RNA transcription.

64. An expression cassette for the expression of a desired eukaryotic molecule within a plastid comprising a suitable promoter operably linked to a eukaryotic transgene of interest, wherein said eukaryotic molecule comprises an antibody.

65. The expression cassette of claim 64, wherein the promoter is a homologous promoter.

66. The expression cassette of claim 64, wherein the promoter is a psbA promoter.

67. The expression cassette of claim 64, further comprising a 5' UTR.

68. The expression cassette of claim 67, wherein the 5'UTR further comprises a RB47 binding site sequence.

69. The expression cassette of claim 67, further comprising a 3' UTR.

70. The expression cassette of claim 64, wherein the plastid comprises a chloroplast.

71. The expression cassette of claim 64, wherein the antibody is a single chain antibody.

72. The expression cassette of claim 64, wherein the antibody is a dimeric antibody.

73. The expression cassette of claim 64, wherein the expression cassette further encodes a luciferase enzyme.

74. The expression cassette of claim 64, wherein the promoter is constitutive.

75. The expression cassette of claim 64, wherein the promoter is inducible.

76. The expression cassette of claim 64, wherein the promoter is a eukaryotic promoter.

77. The expression cassette of claim 64, wherein the promoter is a prokaryotic promoter.

78. The expression cassette of claim 64, further comprising an origin of replication.

79. The expression cassette of claim 64, further comprising a selectable marker.

80. A cell comprising the expression cassette of claim 64.

81. The cell of claim 80, wherein the cell is a plant cell.

82. The cell of claim 81, wherein the plant cell comprises a plastid.

83. The cell of claim 82, wherein the plastid comprises a chloroplast.

84. The cell of claim 81, wherein the plant cell comprises a mitochondria.

85. The cell of claim 80, wherein the cell is an algae cell.

86. The cell of claim 85, wherein the cell is a Chlamydomonas reinhardtii cell.

87. A method for producing a eukaryotic protein of interest comprising transforming a plastid with the expression cassette of claim 64, allowing the cell to grow, and harvesting the protein.

88. The method of claim 87, wherein the plastid is comprised within a plant cell.

89. The method of claim 87, wherein the plastid is comprised within an algae cell.

90. The method of claim 87, wherein the transformation occurs in vitro.

91. The method of claim 87, wherein the transformation occurs in vivo.

92. The method of claim 87, wherein the transformation occurs ex vivo.

93. The expression cassette of claim 64, wherein the promoter is a heterologous promoter.

94. The expression cassette of claim 64, wherein the promoter is a bacterial promoter, bacteriophage promoter, T3 promoter or a T7 promoter.

95. The expression cassette of claim 64, wherein the promoter is a constitutive promoter or an inducible promoter.

96. A DNA construct for expression of a transgene within a plastid comprising a promoter functional in a plastid operably linked to a gene of interest, wherein said transgene comprises a gene encoding an antibody.

97. The expression cassette of claim 65, further comprising a 5' UTR.

98. The expression cassette of claim 65, wherein the plastid comprises a chloroplast.

99. The expression cassette of claim 65, further comprising an origin of replication.

100. The expression cassette of claim 65, further comprising a selectable marker.
Description: TECHNICAL FIELD

The invention relates to expression systems and methods for expression of desired genes and gene products in cells. Particularly, the invention relates to a gene encoding a RNA binding protein useful for regulating gene expression in cells, theprotein binding site, a gene encoding a regulating protein disulfide isomerase and methods and systems for gene expression of recombinant molecules.

BACKGROUND

Expression systems for expression of exogenous foreign genes in eukaryotic and prokaryotic cells are basic components of recombinant DNA technology. Despite the abundance of expression systems and their wide-spread use, they all havecharacteristic disadvantages. For example, while expression in E. coli is probably the most popular as it is easy to grow and is well understood, eukaryotic proteins expressed therein are not properly modified. Moreover, those proteins tend toprecipitate into insoluble aggregates and are difficult to obtain in large amounts. Mammalian expression systems, while practical on small-scale protein production, are more difficult, time-consuming and expensive than in E. coli.

A number of plant expression systems exist as well as summarized in U.S. Pat. No. 5,234,834, the disclosures of which are hereby incorporated by reference. One advantage of plants or algae in an expression system is that they can be used toproduce pharmacologically important proteins and enzymes on a large scale and in relatively pure form. In addition, micro-algae have several unique characteristics that make them ideal organisms for the production of proteins on a large scale. First,unlike most systems presently used to produce transgenic proteins, algae can be grown in minimal media (inorganic salts) using sunlight as the energy source. These algae can be grown in contained fermentation vessels or on large scale in monitoredponds. Ponds of up to several acres are routinely used for the production of micro-algae. Second, plants and algae have two distinct compartments, the cytoplasm and the chloroplast, in which proteins can be expressed. The cytoplasm of algae is similarto that of other eukaryotic organisms used for protein expression, like yeast and insect cell cultures. The chloroplast is unique to plants and algae and proteins expressed in this environment are likely to have properties different from those ofcytoplasmically expressed proteins.

The present invention describes an expression system in which exogenous molecules are readily expressed in either prokaryotic or eukaryotic hosts and in either the cytoplasm or chloroplast. These beneficial attributes are based on the discoveryand cloning of components of translation regulation in plants as described in the present invention.

Protein translation plays a key role in the regulation of gene expression across the spectrum of organisms (Kozak, Ann. Rev. Cell Biol., 8:197-225 (1992) and de Smit and Van Duin, Prog. Nucleic Acid Res. Mol. Biol., 38:1-35 (1990)). Themajority of regulatory schemes characterized to date involve translational repression often involving proteins binding to mRNA to limit ribosome association (Winter et al., Proc. Natl. Acad. Sci., USA, 84:7822-7826 (1987) and Tang and Draper,Biochem., 29:4434-4439 (1990)). Translational activation has also been observed (Wulczyn and Kahmann, Cell, 65:259-269 (1991)), but few of the underlying molecular mechanisms for this type of regulation have been identified. In plants, light activatesthe expression of many genes. Light has been shown to activate expression of specific chloroplast encoded mRNAs by increasing translation initiation (Mayfield et al., Ann. Rev. Plant Physiol. Plant Mol. Biol., 46:147-166 (1995) and Yohn et al., Mol.Cell Biol., 16:3560-3566 (1996)). Genetic evidence in higher plants and algae has shown that nuclear encoded factors are required for translational activation of specific chloroplast encoded mRNAs (Rochaix et al., Embo J., 8:1013-1021 (1989), Kuchka etal., Cell, 58:869-876 (1989), Girard-Bascou et al., Embo J., 13:3170-3181 (1994), Kim et al, Plant Mol. Biol., 127:1537-1545 (1994).

In the green algae Chlamydomonas reinhardtii, a number of nuclear mutants have been identified that affect translation of single specific mRNAs in the chloroplast, often acting at translation initiation (Yohn et al., supra, (1996)). Mutationalanalysis of chloroplast mRNAs has identified sequence elements within the 5' untranslated region (UTR) of mRNAs that are required for translational activation (Mayfield et al., supra, (1995), Mayfield et al., J. Cell Biol., 127:1537-1545 (1994) andRochaix, Ann. Rev. Cell Biol., 8:1-28 (1992)), and the 5' UTR of a chloroplast mRNA can confer a specific translation phenotype on a reporter gene in vivo (Zerges and Rochaix, Mol. Cell Biol., 14:5268-5277 (1994) and Staub and Maliga, Embo J.,12:601-606 (1993).

Putative translational activator proteins were identified by purifying a complex of four proteins that binds with high affinity and specificity to the 5' UTR of the chloroplast encoded psbA mRNA [encoding the D1 protein, a major component ofPhotosystem II (PS II)] (Danon and Mayfield, Embo J., 10.3993-4001 (1991)). Binding of these proteins to the 5' UTR of psbA mRNA correlates with translation of this mRNA under a variety of physiological (Danon and Mayfield, id., (1991)) and biochemicalconditions (Danon and Mayfield, Science, 266:1717-1719 (1994) and Danon and Mayfield, Embo J., 13:2227-2235 (1994)), and in different genetic backgrounds (Yohn et al., supra, (1996)). The binding of this complex to the psbA mRNA can be regulated invitro in response to both redox potential (Danon and Mayfield, Science, 266:1717-1719 (1994)) and phosphorylation (Danon and Mayfield, Embo J., 13:2227-2235 (1994)), both of which are thought to transduce the light signal to activate translation of psbAmRNA. The 47 kDa member of the psbA RNA binding complex (RB47) is in close contact with the RNA, and antisera specific to this protein inhibits binding to the psbA mRNA in vitro (Danon and Mayfield, supra, (1991)).

Although the translational control of psbA mRNA by RB47 has been reported, the protein has not been extensively characterized and the gene encoding RB47 has not been identified, cloned and sequenced. In addition, the regulatory control of theactivation of RNA binding activity to the binding site by nuclear-encoded trans-acting factors, such as RB60, have not been fully understood. The present invention now describes the cloning and sequencing of both RB47 and RB60. Based on the translationregulation mechanisms of RB47 and RB60 with the RB47 binding site, the present invention also describes a translation regulated expression system for use in both prokaryotes and eukaryotes.

BRIEF DESCRIPTION OF THE INVENTION

The RB47 gene encoding the RB47 activator protein has now been cloned and sequenced, and the target binding site for RB47 on messenger RNA (mRNA) has now been identified. In addition, a regulatory protein disulfide isomerase, a 60 kilodaltonprotein referred to as RB60, has also been cloned, sequenced and characterized. Thus, the present invention is directed to gene expression systems in eukaryotic and prokaryotic cells based on translational regulation by RB47 protein, its binding siteand the RB60 regulation of RB47 binding site activation.

More particularly, the present invention describes the use of the RB47 binding site, i.e., a 5' untranslated region (UTR) of the chloroplast psbA gene, in the context of an expression system for regulating the expression of genes encoding adesired recombinant molecule. Protein translation is effected by the combination of the RB47 binding site and the RB47 binding protein in the presence of protein translation components. Regulation can be further imposed with the use of the RB60regulatory protein disulfide isomerase. Therefore, the present invention describes reagents and expression cassettes for controlling gene expression by affecting translation of a coding nucleic acid sequence in a cell expression system.

Thus, in one embodiment, the invention contemplates a RB47 binding site sequence, i.e., a mRNA sequence, typically a mRNA leader sequence, which contains the RB47 binding site. A preferred RB47 binding site is psbA mRNA. For use in expressingrecombinant molecules, the RB47 binding site is typically inserted 5' to the coding region of the preselected molecule to be expressed. In a preferred embodiment, the RB47 binding site is inserted into the 5' untranslated region along with an upstreampsbA promoter to drive the expression of a preselected nucleic acid encoding a desired molecule. In alternative embodiments, the RB47 binding site is inserted into the regulatory region downstream of any suitable promoter present in a eukaryotic orprokaryotic expression vector. Preferably, the RB47 binding site is positioned within 100 nucleotides of the translation initiation site. In a further aspect, 3' to the coding region is a 3' untranslated region (3' UTR) necessary for transcriptiontermination and RNA processing.

Thus, in a preferred embodiment, the invention contemplates an expression cassette or vector that contains a transcription unit constructed for expression of a preselected nucleic acid or gene such that upon transcription, the resulting mRNAcontains the RB47 binding site for regulation of the translation of the preselected gene transcript through the binding of the activating RB47 protein. The RB47 protein is provided endogenously in a recipient cell and/or is a recombinant proteinexpressed in that cell.

Thus, the invention also contemplates a nucleic acid molecule containing the sequence of the RB47 gene. The nucleic acid molecule is preferably in an expression vector capable of expressing the gene in a cell for use in interacting with a RB47binding site. The invention therefore contemplates an expressed recombinant RB47 protein. In one embodiment, the RB47 binding site and RB47 encoding nucleotide sequences are provided on the same genetic element. In alternative embodiments, the RB47binding site and RB47 encoding nucleotide sequences are provided separately.

The invention further contemplates a nucleic acid molecule containing the sequence encoding the 69 kilodalton precursor to RB47. In alternative embodiments, the RB47 nucleic acid sequence contains a sequence of nucleotides to encode a histidinetag. Thus, the invention relates to the use of recombinant RB47, precursor RB47, and histidine-modified RB47 for use in enhancing translation of a desired nucleic acid.

The invention further contemplates a nucleic acid molecule containing a nucleotide sequence of a polypeptide which regulates the binding of RB47 to RB47 binding site. A preferred regulatory molecule is the protein disulfide isomerase RB60. TheRB60-encoding nucleic acid molecule is preferably in an expression vector capable of expressing the gene in a cell for use in regulating the interaction of RB47 with a RB47 binding site. Thus, the invention also contemplates an expressed recombinantRB60 protein. In one embodiment, the RB47 binding site, RB47 encoding and RB60 encoding nucleotide sequences are provided on the same genetic element. In alternative embodiments, the expression control nucleotide sequences are provided separately. Ina further aspect, the RB60 gene and RB47 binding site sequence are provided on the same construct.

The invention can therefore be a cell culture system, an in vitro expression system or a whole tissue, preferably a plant, in which the transcription unit is present that contains the RB47 binding site and further includes a (1) transcriptionunit capable of expressing RB47 protein or (2) the endogenous RB47 protein itself for the purpose of enhancing translation of the preselected gene having an RB47 binding site in the mRNA. Preferred cell culture systems are eukaryotic and prokaryoticcells. Particularly preferred cell culture systems include plants and more preferably algae.

A further preferred embodiment includes (1) a separate transcription unit capable of expressing a regulatory molecule, preferably RB60 protein, or (2) the endogenous RB60 protein itself for the purpose of regulating translation of the preselectedgene having an RB47 binding site in the mRNA. In an alternative preferred embodiment, one transcription unit is capable of expressing both the RB47 and RB60 proteins. In a further aspect, the RB47 binding site sequence and RB60 sequence are provided onthe same construct.

In one aspect of the present invention, plant cells endogenously containing RB47 and RB60 proteins are used for the expression of recombinant molecules, such as proteins or polypeptides, through activation of the RB47 binding in an exogenouslysupplied expression cassette. Alternatively, stable plant cell lines containing endogenous RB47 and RB60 are first generated in which RB47 and/or RB60 proteins are overexpressed. Overexpression is obtained preferably through the stable transformationof the plant cell with one or more expression cassettes for encoding recombinant RB47 and RB60. In a further embodiment, stable cell lines, such as mammalian or bacterial cell lines, lacking endogenous RB47 and/or RB60 proteins are created that expressexogenous RB47 and/or RB60.

Plants for use with the present invention can be a transgenic plant, or a plant in which the genetic elements of the invention have been introduced. Based on the property of controlled translation provided by the combined use of the RB47 proteinand the RB47 binding site, translation can be regulated for any gene product, and the system can be introduced into any plant species. Similarly, the invention is useful for any prokaryotic or eukaryotic cell system.

Methods for the preparation of expression vectors is well known in the recombinant DNA arts, and for expression in plants is well known in the transgenic plant arts. These particulars are not essential to the practice of the invention, andtherefore will not be considered as limiting.

The invention allows for high level of protein synthesis in plant chloroplasts and in the cytoplasm of both prokaryotic and eukaryotic cells. Because the chloroplast is such a productive plant organ, synthesis in chloroplasts is a preferred siteof translation by virtue of the large amounts of protein that can be produced. This aspect provides for great advantages in agricultural production of mass quantities of a preselected protein product.

The invention further provides for the ability to screen for agonists or antagonists of the binding of RB47 to the RB47 binding site using the expression systems as described herein. Antagonists of the binding are useful in the prevention ofplant propagation.

Also contemplated by the present invention is a screening assay for agonists or antagonists of RB60 in a manner analogous to that described above for RB47. Such agonists or antagonists would be useful in general to modify expression of RB60 as away to regulate cellular processes in a redox manner.

Kits containing expression cassettes and expression systems, along with packaging materials comprising a label with instructions for use, as described in the claimed embodiments are also contemplated for use in practicing the methods of thisinvention.

Other uses will be apparent to one skilled in the art in light of the present disclosures.

BRIEF DESCRIPTION OF DRAWINGS

In the figures forming a portion of this disclosure:

FIGS. 1A-1D show the complete protein amino acid residue sequence of RB47 is shown from residues 1-623, together with the corresponding nucleic acid sequence encoding the RB47 sequence, from base 1 to base 2732. The nucleotide coding region isshown from base 197-2065, the precursor form. The mature form is from nucleotide position 197-1402. Also shown is the mRNA leader, bases 1-196, and poly A tail of the mRNA, bases 2066-2732. Both the nucleotide and amino acid sequence are listed in SEQID NO 5.

FIGS. 2A-2B show the complete protein amino acid residue sequence of RB60 is shown from residues 1-488, together with the corresponding nucleic acid sequence from base 1 to base 2413, of which bases 16-1614 encode the RB60 sequence. Both thenucleotide and amino acid sequence are listed in SEQ ID NO 10.

FIGS. 3A-3C show the complete sequence of the psbA mRNA, showing both encoded psbA protein amino acid residue sequence (residues 1-352) and the nucleic acid sequence as further described in Example 3 is illustrated. Both the nucleotide and aminoacid sequence are listed in SEQ ID NO 13.

FIG. 4 is a schematic diagram of an expression cassette containing on one transcription unit from 5' to 3', a promoter region derived from the psbA gene for encoding the D1 protein from C. reinhardtii further containing a transcription initiationsite (TS), the RB47 biding site, a region for insertion of a foreign or heterologous coding region, a RB47 coding region, a RB60 coding region, and the 3' flanking region containing transcription termination site (TS), flanked by an origin of replicationand selection marker. Restriction endonuclease sites for facilitating insertion of the independent genetic elements are indicated and further described in Example 4A.

FIGS. 5A-5B show the nucleotide and amino acid sequence of the RB47 molecule containing a histidine tag, the sequences of which are also listed in SEQ ID NO 14.

FIG. 6 is a schematic diagram of an expression cassette containing on one transcription unit from 5' to 3', a promoter region derived from the psbA gene for encoding the D1 protein from C. reinhardtii further containing a transcription initiationsite (TS), the RB47 binding site, a region for RB47 is also shown in FIGS. 1A-1D (SEQ ID NO 5). As described in Section 2 above, the predicted protein sequence from the cloned cDNA contained both the derived peptide sequences of RB47 and is highlyhomologous to poly(A) binding proteins (PABP) from a variety of eukaryotic organisms.

FIG. 7 diagrams a construct is essentially pD1/Nde including a heterologous coding sequence having a 3' XbaI restriction site for ligation with the 3' psbA gene.

FIG. 8 shows two of the transformants that contained the single chain chimeric gene produced single chain antibodies at approximately 1% of total protein levels.

FIG. 9 shows a construct, the bacterial LuxAB coding region was ligated between the psbA 5' UTR and the psbA 3' end in an E. coli plasmid.

FIG. 10 shows luciferase activity accumulated with the chloroplast.

FIG. 11 shows a construct engineered so that the psbA promoter and 5' UTR are used to drive the synthesis of the light chain and heavy chains of an antibody, and the J chain normally associated with IgA molecules.

2 CLONING OF RB60

To clone the cDNA encoding the 60 kDa psbA mRNA binding protein (RB60), the psbA-specific RNA binding proteins were purified from light-grown C. reinhardtii cells using heparin-agarose chromatography followed by psbA RNA affinity chromatography(RAC). RAC-purified proteins were separated by two-dimensional polyacrylamide gel electrophoresis. The region corresponding to RB60 was isolated from the PVDF membrane. RB60 protein was then digested with trypsin. Unambiguous amino acid sequenceswere obtained from two peptide tryptic fragments (WFVDGELASDYNGPR (SEQ ID NO 6) and (QLILWTTADDLKADAEIMTVFR (SEQ ID NO 7)) as described above for RB47. The calculated molecular weights of the two tryptic peptides used for further analysis preciselymatched with the molecular weights determine by mass spectrometry. The DNA sequence corresponding to one peptide of 22 amino acid residues was amplified by PCR using degenerate oligonucleotides, the forward primer 5'CGCGGATCCGAYGCBGAGATYATGAC3' (SEQ IDNO 8) and the reverse primer 5'CGCGAATTCGTCATRATCTCVGCRTC3' (SEQ ID NO 9), where R can be A or G (the other IUPAC nucleotides have been previously defined above) The amplified sequence was then used to screen a .lamda.-gt10 cDNA library from C.reinhardtii. Three clones were identified with the largest being 2 2 kb. Selection and sequencing was performed as described for RB47 cDNA.

The resulting RB60 cDNA sequence is available via GenBank (Accession Number AF027727). The nucleotide and encoded amino acid sequence of RB60 is also shown in FIGS. 2A-2B (SEQ ID NO 10) The protein coding sequence of 488 amino acid residuescorresponds to nucleotide positions 16-1614 of the 2413 base pair sequence. The predicted amino acid sequence of the cloned cDNA contained the complete amino acid sequences of the two tryptic peptides. The amino acid sequence of the encoded proteinrevealed that it has high sequence homology to both plant and mammalian protein disulfide isomerase (PDI), and contains the highly conserved thioredoxin-like domains with --CysGlyHisCys-- (--CGHC--) (SEQ ID NO 11) catalytic sites in both the N-terminaland C-terminal regions and the --LysAspGluLeu-- (--KDEL--) (SEQ ID NO 12) endoplasmic reticulum (ER) retention signal at the C-terminus found in all PDIs. PDI is a multifunctional protein possessing enzymatic activities for the formation, reduction, andisomerization of disulfide bonds during protein folding, and is typically found in the ER. The first 30 amino acid residues of RB60 were found to lack sequence homology with the N-terminal signal sequence of PDI from plants or mammalian cells. However,this region has characteristics of chloroplast transit peptides of C. reinhardtii, which have similarities with both mitochondrial and higher plant chloroplast presequences. A transit peptide sequence should override the function of the --KDEL-- ERretention signal and target the protein to the chloroplast since the --KDEL-- signal acts only to retain the transported protein in the ER.

3 Preparation of psbA Promoter Sequence and RB47 Binding Site Nucleotide Sequence

The chloroplast psbA gene from the green unicellular alga C. reinhardii was cloned and sequenced as described by Erickson et al., Embo J., 3:2753-2762 (1984), the disclosure of which is hereby incorporated by reference. The DNA sequence of thecoding regions and the 5' and 3' untranslated (UTR) flanking sequences of the C. reinhardii psbA gene is shown in FIGS. 3A-3C. The psbA gene sequence is also available through GenBank as further discussed in Example 4. The nucleotide sequence is alsolisted as SEQ ID NO 13. The deduced amino acid sequence (also listed in SEQ ID NO 13) of the coding region is shown below each codon beginning with the first methionine in the open reading frame. Indicated in the 5' non-coding sequence are a putativeShine-Dalgarno sequence in the dotted box, two putative transcription initiation sites determined by S1 mapping (S1) and the Pribnow-10 sequence in the closed box. Inverted repeats of eight or more base pairs are marked with arrows and labeled A-D. Adirect repeat of 31 base pairs with only two mismatches is marked with arrows labeled 31. Indicated in the 3' non-coding sequence is a large inverted repeat marked by a forward arrow and the SI cleavage site marking the 3' end of the mRNA. Both the 5'and 3' untranslated regions are used in preparing one of the expression cassettes of this invention as further described below.

The 5' UTR as previously discussed contains both the psbA promoter and the RB47 binding site. The nucleotide sequence defining the psbA promoter contains the region of the psbA DNA involved in binding of RNA polymerase to initiate transcription. The -10 sequence component of the psbA promoter is indicated by the boxed nucleotide sequence upstream of the first S1 while the -35 sequence is located approximately 35 bases before the putative initiation site. As shown in FIGS. 3A-3C, the -10sequence is boxed, above which is the nucleotide position (-100) from the first translated codon. The -35 sequence is determined accordingly. A psbA promoter for use in an expression cassette of this invention ends at the first indicated S1 site(nucleotide position -92 as counting from the first ATG) in FIGS. 3A-3C and extends to the 5' end (nucleotide position -251 as shown in FIGS. 3A-3C). Thus, the promoter region is 160 bases in length. A more preferred promoter region extends at least100 nucleotides to the 5' end from the S1 site. A most preferred region contains nucleotide sequence ending at the s1 site and extending 5' to include the -35 sequence, i.e., from -92 to -130 as counted from the first encoded amino acid residue (39bases).

The psbA RB47 binding site region begins at the first S1 site as shown in FIGS. 3A-3C and extends to the first adenine base of the first encoded methionine residue. Thus, a psbA RB47 binding site in the psbA gene corresponds to the nucleotidepositions from .about.91 to .about.1 as shown in FIG. 3A-3C.

The above-identified regions are used to prepare expression constructs as described below. The promoter and RB47 binding site regions can be used separately; for example, the RB47 binding site sequence can be isolated and used in a eukaryotic orprokaryotic plasmid with a non-psbA promoter. Alternatively, the entire psbA 5' UTR having 251 nucleotides as shown in FIGS. 3A-3C is used for the regulatory region in an expression cassette containing both the psbA promoter and RB47 binding sitesequence as described below.

4. Preparation of Expression Vectors and Expression of Coding Sequences

A. Constructs Containing an psbA Promoter, an RB47 Binding Site Nucleotide Sequence, a Desired Heterologous Coding Sequence, an RB47-Encoding Sequence and an RB60-Encoding Sequence

Plasmid expression vector constructs, alternatively called plasmids, vectors, constructs and the like, are constructed containing various combinations of elements of the present invention as described in the following examples. Variations of thepositioning and operably linking of the genetic elements described in the present invention and in the examples below are contemplated for use in practicing the methods of this invention. Methods for manipulating DNA elements into operable expressioncassettes are well known in the art of molecular biology. Accordingly, variations of control elements, such as constitutive or inducible promoters, with respect to prokaryotic or eukaryotic expression systems as described in Section C, are contemplatedherein although not enumerated. Moreover, the expression the various elements is not limited to one transcript producing one mRNA; the invention contemplates protein expression from more than one transcript if desired.

As such, while the examples below recite one or two types of expression cassettes, the genetic elements of RB47 binding site, any desired coding sequence, in combination with RB47 and RB60 coding sequences along with a promoter are readilycombined in a number of operably linked permeations depending on the requirements of the cell system selected for the expression. For example, for expression in a chloroplast, endogenous RB47 protein is present therefore an expression cassette having anRB47 binding site and a desired coding sequence is minimally required along with an operative promoter sequence. Overexpression of RB47 may be preferable to enhance the translation of the coding sequence; in that case, the chloroplast is furthertransformed with an expression cassette containing an RB47-encoding sequence. Although the examples herein and below utilize primarily the sequence encoding the precursor form of RB47, any of the RB47-encoding sequences described in the presentinvention, i.e., RB47 precursor, mature RB47 and histidine-modified RB47 are contemplated for use in any expression cassette and system as described herein. To regulate the activation of translation, an RB60-encoding element is provided to theexpression system to provide the ability to regulate redox potential in the cell as taught in Section B. These examples herein and below represent a few of the possible permutations of genetic elements for expression in the methods of this invention.

In one embodiment, a plasmid is constructed containing an RB47 binding site directly upstream of an inserted coding region for a heterologous protein of interest, and the RB47 and RB60 coding regions. Heterologous refers to the nature of thecoding region being dissimilar and not from the same gene as the regulatory molecules in the plasmid, such as RB47 and RB60. Thus, all the genetic elements of the present invention are produced in one transcript from the IPTG-inducible psbA promoter. Alternative promoters are similarly acceptable.

The final construct described herein for use in a prokaryotic expression system makes a single mRNA from which all three proteins are translated. The starting plasmid is any E. coli based plasmid containing an origin of replication andselectable marker gene. For this example, the Bluescript plasmid, pBS, commercially available through Stratagene, Inc., La Jolla, Calif., which contains a polylinker-cloning site and an ampicilin resistant marker is selected for the vector.

The wild-type or native psbA gene (Erickson et al., Embo J., 3:2753-2762 (1984), also shown in FIGS. 3A-3C, is cloned into pBS at the EcoRI and BamHI sites of the polylinker. The nucleotide sequence of the psbA gene is available on GenBank withthe 5' UTR and 3' UTR respectively listed in Accession Numbers X01424 and X02350. The EcoRI site of psbA is 1.5 kb upstream of the psbA initiation codon and the BamHI site is 2 kb downstream of the stop codon. This plasmid is referred to as pD1.

Using site-directed PCR mutagenesis, well known to one of ordinary skill in the art, an NdeI site is placed at the initiation codon of psbA in the pD1 plasmid so that the ATG of the NdeI restriction site is the ATG initiation codon. This plasmidis referred to as pD1/Nde. An Nde site is then placed at the initiation codon of the gene encoding the heterologous protein of interest and an Xho I site is placed directly downstream (within 10 nucleotides) of the TAA stop codon of the heterologousprotein coding sequence. Again using site-directed mutagenesis, an XhoI site is placed within 10 nucleotides of the initiation codon of RB47, the preparation of which is described in Example 2, and an NotI site is placed directly downstream of the stopcodon of RB47. The heterologous coding region and the RB47 gene are then ligated into pD1/Nde so that the heterologous protein gene is directly adjacent to the RB47 binding site and the RB47 coding region is downstream of the heterologous coding region,using the Xho I site at the heterologous stop codon and the Not I site of the pD1 polylinker.

These genetic manipulations result in a plasmid containing the 5' end of the psbA gene including the promoter region and with the RB47 binding site immediately upstream of a heterologous coding region, and the RB47 coding region immediatelydownstream of the heterologous coding region. The nucleotides between the stop codon of the heterologous coding region and the initiation codon of the RB47 coding region is preferably less than 20 nucleotides and preferably does not contain anyadditional stop codons in any reading frame. This plasmid is referred to as pD1/RB47.

Using site-directed mutagenesis, a NotI site is placed immediately (within 10 nucleotides) upstream of the initiation codon of RB60, the preparation of which is described in Example 2, and an Xba I site is placed downstream of the RB60 stopcodon. This DNA fragment is then ligated to the 3' end of the psbA gene using the Xba I site found in the 3' end of the psbA gene so that the psbA 3' end is downstream of the RB60 coding region. This fragment is then ligated into the pD1/RB47 plasmidusing the NotI and BamHI sites so that the RB60 coding region directly follows the RB47 coding region. The resulting plasmid is designated pD1/RB47/RB60. Preferably there is less then 20 nucleotides between the RB47 and RB60 coding regions andpreferably there are no stop codons in any reading frame in that region. The final plasmid thus contains the following genetic elements operably linked in the 5' to 3' direction: the 5' end of the psbA gene with a promoter capable of directingtranscription in chloroplasts, an RB47 binding site, a desired heterologous coding region, the RB47 coding region, the RB60 coding region, and the 3' end of the psbA gene which contains a transcription termination and mRNA processing site, and an E. coliorigin of replication and amplicillin resistance gene. A diagram of this plasmid with the restriction sites is shown in FIG. 4.

Expression of pD1/RB47/RB60 in E. coli to produce recombinant RB47, RB60 and the recombinant heterologous protein is performed as described in Example 4B. The heterologous protein is then purified as further described.

Expression cassettes in which the sequences encoding RB47 and RB60 are similarly operably linked to a heterologous coding sequence having the psbA RB47 binding site as described in Example 3 are prepared with a different promoter for use ineukaryotic, such as mammalian expression systems. In this aspect, the cassette is similarly prepared as described above with the exception that restriction cloning sites are dependent upon the available multiple cloning sites in the recipient vector. Thus, the RB47 binding site prepared in Example 3 is prepared for directed ligation into a selected expression vector downstream of the promoter in that vector. The RB47 and RB60 coding sequences are obtained from the pD1/RB47/RB60 plasmid by digestionwith XhoI and XbaI and inserted into a similarly digested vector if the sites are present. Alternatively, site-directed mutagenesis is utilized to create appropriate linkers. A desired heterologous coding sequence is similarly ligated into the vectorfor expression.

B. Constructs Containing RB47 Nucleotide Sequence

1) Purified Recombinant RB47 Protein

In one approach to obtain purified recombinant RB47 protein, the full length RB47 cDNA prepared above was cloned into the E. coli expression vector pET3A (Studier et al., Methods Enzymol., 185:60-89 (1990)), also commercially available byNovagen, Inc., Madison, Wis. and transformed into BL21 E. coli cells. The cells were grown to a density of 0.4 (OD.sub.600), then induced with 0.5 mM IPTG. Cells were then allowed to grow for an additional 4 hours, at which point they were pelletedand frozen.

Confirmation of the identity of the cloned cDNA as encoding the authentic RB47 protein was accomplished by examining protein expressed from the cDNA by immunoblot analysis and by RNA binding activity assay. The recombinant RB47 protein producedwhen the RB47 cDNA was expressed was recognized by antisera raised against the C. reinhardtii RB47 protein. The E. coli expressed protein migrated at 80 kDa on SDS-PAGE, but the protein was actually 69 kDa, as determined by mass spectrometry of the E.coli expressed protein. This mass agrees with the mass predicted from the cDNA sequence. A 60 kDa product was also produced in E. coli, and recognized by the antisera against the C. reinhardtii protein, which is mot likely a degradation or earlytermination product of the RB47 cDNA. The recombinant RB47 protein expressed from the RB47 cDNA is recognized by the antisera raised against the C. reinhardtii protein at levels similar to the recognition of the authentic C. reinhardtii RB47 protein,demonstrating that the cloned cDNA produces a protein product that is immunologically related to the naturally produced RB47 protein. In order to generate a recombinant equivalent of the endogenous native RB47, the location of the 47 kDa polypeptide wasmapped on the full-length recombinant protein by comparing mass spectrometric data of tryptic digests of the C. reinhardtii 47 kDa protein and the full-length recombinant protein. Thus, peptide mapping by mass spectrometry has shown that the endogenousRB47 protein corresponds primarily to the RNA binding domains contained within the N-terminal region of the predicted precursor protein, suggesting that a cleavage event is necessary to produce the mature 47 kDa protein. Thus, full-length recombinantRB47 is 69 kDa and contains a carboxy domain that is cleaved in vivo to generate the endogenous mature form of RB47 that is 47 kDa.

To determine if the heterologously expressed RB47 protein was capable of binding the psbA RNA, the E. coli expressed protein was purified by heparin agarose chromatography. The recombinant RB47 protein expressed in E. coli was purified using aprotocol similar to that used previously for purification of RB47 from C. reinhardtii. Approximately 5 g of E. coli cells grown as described above were resuspended in low salt extraction buffer (10 mM Tris [pH 7.5], 10 mM NaCl, 10 mM MgCl.sub.2, 5 mM.beta.-mercaptoethanol) and disrupted by sonication. The soluble cell extract was applied to a 5 mL Econo-Pac heparin cartridge (Bio-Rad) which was washed prior to elution of the RB47 protein (Danon and Mayfield, Embo J., 10:3993-4001 (1991)).

The E. coli expressed protein that bound to the heparin agarose matrix was eluted from the column at the same salt concentration as used to elute the authentic C. reinhardtii RB47 protein. This protein fraction was used in in vitro bindingassays with the psbA 5' UTR. Both the 69 and 60 kDa E. coli expressed proteins crosslinked to the radiolabeled psbA 5' UTR at levels similar to crosslinking of the endogenous RB47 protein, when the RNA/protein complex is subjected to UV irradiation.

Heparin agarose purified proteins, both from the E. coli expressed RB47 cDNA and from C. reinhardtii cells, were used in an RNA gel mobility shift assay to determine the relative affinity and specificity of these proteins for the 5' UTR of thepsbA mRNA. The E. coli expressed proteins bound to the psbA 5' UTR in vitro with properties that are similar to those of the endogenous RB47 protein purified from C. reinhardtii. RNA binding to both the E. coli expressed and the endogenous RB47 proteinwas competed using either 200 fold excess of unlabeled psbA RNA or 200 fold excess of poly(A) RNA. RNA binding to either of these proteins was poorly competed using 200 fold excess of total RNA or 200 fold excess of the 5' UTR of the psbD or psbC RNAs. Different forms of the RB47 protein (47 kDa endogenous protein vs. the 69 kDa E. coli expressed protein) may account for the slight differences in mobility observed when comparing the binding profiles of purified C. reinhardtii protein to heterologouslyexpressed RB47.

The mature form of RB47 i also produced in recombinant form by the insertion by PCR of an artificial stop codon in the RB47 cDNA at nucleotide positions 1403-1405 with a stop codon resulting in a mature RB47 recombinant protein having 402 aminoacids as shown in FIGS. 1A-1D. An example of this is shown in FIGS. 5A-5B for the production of a recombinant histidine-modified RB47 mature protein as described below. The complete RB47 cDNA is inserted into an expression vector, such as pET3A asdescribed above, for expression of the mature 47 kDa form of the RB47 protein. In the absence of the inserted stop codon, the transcript reads through to nucleotide position 2066-2068 at the TAA stop codon to produce the precursor RB47 having theabove-described molecular weight characteristics and 623 amino acid residues.

Recombinant RB47 is also expressed and purified in plant cells. For this aspect, C. reinhardtii strains were grown in complete media (Tris-acetate-phosphate [TAP] (Harris, The Chlamydonas Sourcebook, San Diego, Calif., Academic Press (1989)) toa density of 5.times.10.sup.6 cells/mL under constant light. Cells were harvested by centrifugation at 4.degree. C. for 5 minutes at 4,000 g Cells were either used immediately or frozen in liquid N.sub.2 for storage at -70.degree. C.

Recombinant RB47 protein was also produced as a modified RB47 protein with a histidine tag at the amino-terminus according to well known expression methods using pET19-D vectors available from Novagen, Inc., Madison, Wis. The nucleotide andamino acid sequence of a recombinant histidine-modified RB47 of the mature 47 kDa form is shown in FIGS. 5A-5B with the nucleotide and amino acid sequence also listed in SEQ ID NO 14. Thus the nucleotide sequence of a histidine-modified RB47 is 1269bases in length. The precursor form of the RB47 protein is similarly obtained in the expression system, both of which are modified by the presence of a histidine tag that allows for purification by metal affinity chromatography.

The recombinant histidine-modified RB47 purified through addition of a poly-histidine tag followed by Ni.sup.+2 column chromatography showed similar binding characteristics as that described for recombinant precursor RB47 described above.

C. Constructs Containing RB60 Nucleotide Sequence

In one approach to obtain purified recombinant RB60 protein, the full-length RB60 cDNA prepared above was cloned into the E. coli expression vector pET3A (Studier et al., Methods Enzymol., 185:60-89 (1990)), also commercially available byNovagen, Inc., Madison, Wis. and transformed into BL21 E coli cells. The cells were grown to a density of 0 4 (OD.sub.600), then induced with 0.5 mM IPTG. Cells were then allowed to grow for an additional 4 hours, at which point they were pelleted andfrozen.

Recombinant histidine-modified RB60 was also expressed with a pET19-D vector as described above for RB47 that was similarly modified. Purification of the recombinant RB60 proteins was performed as described for RB47 thereby producing recombinantRB60 proteins for use in the present invention.

The RB60 coding sequence is also mutagenized for directional ligation into an selected vector for expression in alternative systems, such as mammalian expression systems.

D. Constructs Containing an RB47-Encoding Sequence and an RB60-Encoding Sequence

To prepare an expression cassette for encoding both RB47 and RB60, one approach is to digest plasmid pD1/RB47/RB60 prepared above with XhoI and XbaI to isolate the fragment for both encoding sequences. The fragment is then inserted into asimilarly digested expression vector if available or is further mutagenized to prepare appropriate restriction sites.

Alternatively, the nucleotide sequences of RB47 and RB60, as described in Example 2, are separately prepared for directional ligation into a selected vector.

An additional embodiment of the present invention is to prepare an expression cassette containing the RB47 binding site along with the coding sequences for RB47 and RB60, the plasmid pD1/RB47/RB60 prepared above is digested with NdeI and XhoI toprepare an expression cassette in which any desired coding sequence having similarly restriction sites is directionally ligated. Expression vectors containing both the RB47 and RB60 encoding sequences in which the RB47 binding site sequence is utilizedwith a different promoter are also prepared as described in Example 4A.

E. Constructs Containing an RB47 Binding Site Nucleotide Sequence, Insertion Sites for a Desired Heterologous Coding Sequence, and an RB47-Encoding Sequence

In another permutation, a plasmid or expression cassette is constructed containing an RB47 binding site directly upstream of an inserted coding region for a heterologous protein of interest, and the RB47 coding region. The final constructdescribed herein for use in a prokaryotic expression system makes a single mRNA from which both proteins are translated.

The plasmid referred to as pD1/RB47 is prepared as described above in Example 4A. A diagram of this plasmid with the restriction sites is shown in FIG. 6.

Expression of pD1/RB47 in E. coli to produce recombinant RB47 and the recombinant heterologous protein is performed as described in above. The heterologous protein is then purified as further described.

To produce an expression cassette that allows for insertion of an alternative desired coding sequence, the plasmid pD1/RB47 is digested with NdeI and XhoI resulting in a vector having restriction endonuclease sites for insertion of a desiredcoding sequence operably linked to a RB47 binding site and RB47 coding sequence on one transcriptional unit.

F. Constructs Containing an RB47 Binding Site Nucleotide Sequence, Insertion Sites for a Desired Heterologous Coding Sequence, and an RB47-Encoding Sequence

In another permutation, a plasmid or expression cassette is constructed containing an RB47 binding site directly upstream of an inserted coding region for a heterologous protein of interest, and the RB60 coding region The final constructdescribed herein for use in a prokaryotic expression system makes a single mRNA from which both proteins are translated. In this embodiment, a separate construct encoding recombinant RB47 as described in Example 4B is co-transformed into the E. colihost cell for expression.

The plasmid referred to as pD1/RB60 is prepared as described above for pD1/RB47 in Example 4A with the exception that XhoI and XbaI sites are created on RB60 rather than RB47.

Expression of pD1/RB60 in E. coli to produce recombinant RB60 and the recombinant heterologous protein is performed as described in above with the combined expression of RB47 from a separate expression cassette. The heterologous protein is thenpurified as further described.

To produce an expression cassette that allows for insertion of an alternative desired coding sequence, the plasmid pD1/RB60 is digested with NdeI and XhoI resulting in a vector having restriction endonuclease sites for insertion of a desiredcoding sequence operably linked to a RB47 binding site and RB60 coding sequence on one transcriptional unit

G. Constructs Containing RB47 Binding Site Nucleotide Sequence and Heterologous Coding Sequences

1) Expression of Recombinant Tetanus Toxin Single Chain Antibody

The examples herein describe constructs that are variations of those described above. The constructs described below contain an RB47 binding site sequence and a heterologous coding sequence. The activating protein RB47 was endogenously providedin the chloroplast and or plant cell. In other aspects however as taught by the methods of the present invention, the chloroplast is further transformed with an RB47-expression construct as described above for over-expression of RB47 to enhancetranslation capacities.

A strain of the green algae Chlamydomonas reinhardtii was designed to allow expression of a single chain antibody gene in the chloroplast. The transgenically expressed antibody was produced from a chimeric gene containing the promoter and 5'untranslated region (UTR) of the chloroplast psbA gene prepared as described above, followed by the coding region of a single chain antibody (encoding a tetanus toxin binding antibody), and then the 3' UTR of the psbA gene also prepared as describedabove to provide for transcription termination and RNA processing signals. This construct is essentially pD1/Nde including a heterologous coding sequence having a 3' XbaI restriction site for ligation with the 3' psbA gene and is diagramed in FIG. 7.

The psbA-single chain construct was first transformed into C. reinhardtii chloroplast and transformants were then screened for single chain gene integration. Transformation of chloroplast was performed via bolistic delivery as described in U.S. Pat. Nos. 5,545,818 and 5,553,878, the disclosures of which are hereby incorporated by reference. Transformation is accomplished by homologous recombination via the 5' and 3' UTR of the psbA mRNA.

As shown in FIG. 8, two of the transformants that contained the single chain chimeric gene produced single chain antibodies at approximately 1% of total protein levels. The transgenic antibodies were of the correct size and were completelysoluble, as would be expected of a correctly folded protein. Few degradation products were detectable by this Western analysis, suggesting that the proteins were fairly stable within the chloroplast. To identify if the produced antibody retained thebinding capacity for tetanus toxin, ELISA assays were performed using a mouse-produced Fab, from the original tetanus toxin antibody, as the control. The chloroplast single chain antibody bound tetanus toxin at levels similar to Fab, indicating that thesingle chain antibody produced in C. reinhardtii is a fully functional antibody. These results clearly demonstrate the ability of the chloroplast to synthesis and accumulate function antibody molecules resulting from the translational activation of anRB47 binding site in an expression cassette by endogenous RB47 protein in the chloroplast.

2) Expression of Bacterial Luciferase Enzyme Having Two Subunits

For the production of molecules that contain more than one subunit, such as dIgA and bacterial luciferase enzyme, several proteins must be produced in stoichiometric quantities, within the chloroplast. Chloroplast have an advantage for this typeof production over cytoplasmic protein synthesis in that translation of multiple proteins can originate from a single mRNA. For example, a dicistronic mRNA having 5' and 3' NdeI and XbaI restriction sites and containing both the A and B chains of thebacterial luciferase enzyme was inserted downstream of the psbA promoter and 5' UTR of the pD1/Nde construct prepared in Example 4A above. In this construct, the bacterial LuxAB coding region was ligated between the psbA 5' UTR and psbA 3' end in an E.coli plasmid that was then transformed into Chlamydomonas reinhardtii cells as described above for expression in the chloroplast. A schematic of the construct is shown in FIG. 9. Single transformant colonies were then isolated. A plate containing asingle isolate was grown for 10 days on complete media and a drop of the luciferase substrate n-Decyl Aldehyde was placed on the plate and the luciferase visualized by video-photography in a dark chamber. Both proteins were synthesized from this singlemRNA and luciferase activity accumulated within the chloroplast as shown in FIG. 10. Some mRNA within plastids contained as many as 5 separate proteins encoded on a single mRNA.

3) Expression of Dimeric IgA

To generate dimeric IgA, the construct shown in FIG. 11 is engineered so that the psbA promoter and 5' UTR are used to drive the synthesis of the light chain and heavy chains of an antibody, and the J chain normally associated with IgA molecules. The nucleic acid sequences for the dimeric IgA are inserted into the RB47 binding site construct prepared in Example 4A. The construct is then transformed into C. reinhardtii cells as previously described for expression of the recombinant dIgA.

Production of these three proteins, within the plastid allows for the self assembly of a dimeric IgA (dIgA). Production of this complex is monitored in several ways. First, Southern analysis of transgenic algae is used to identify strainscontaining the polycistronic chimeric dIgA gene. Strains positive for integration of the dIgA gene are screened by Northern analysis to ensure that the chimeric mRNA is accumulating. Western blot analysis using denaturing gels is used to monitor theaccumulation of the individual light, heavy and J chain proteins, and native gels Western blot analysis will be used to monitor the accumulation of the assembled dIgA molecule.

By using a single polycistronic mRNA in the context of RB47 regulated translation, two of the potential pitfalls in the assembly of multimeric dIgA molecule are overcome. First, this construct ensures approximately stoichiometric synthesis ofthe subunits, as ribosomes reading through the first protein are likely to continue to read through the second and third proteins as well. Second, all of the subunits are synthesized in close physical proximity to each other, which increases theprobability of the proteins self assembling into a multimeric molecule. Following the production of a strain producing dIgA molecules, the production of dIgA on an intermediate scale by growing algae in 300 liter fermentors is then performed. Largerproduction scales are then performed thereafter.

The foregoing specification, including the specific embodiments and examples, is intended to be illustrative of the present invention and is not to be taken as limiting. Numerous other variations and modifications can be effected withoutdeparting from the true spirit and scope of the invention.

>

TChlamydomonas reinhardtii r Gly Phe Val His Phe Glu Asp Gln Ala Ala Ala Asp Arg TChlamydomonas reinhardtii 2Gly Phe Gly Phe Ile Asn PheLys Asp Ala Glu Ser Ala Ala 32DNAArtificial SequenceDescription of Artificial Sequence oligonucleotide primer 3cagtacggyt tcgtbcaytt cgaggaycag gc 3244ificial SequenceDescription of Artificial Sequence oligonucleotide primer 4ggaattcggyttcggyttca tyaacttcaa ggaygcbgag 4NAChlamydomonas reinhardtiiCDS(2aattcgcgg ccgctccgtg gttggtcctc atggtgtctt tttgaagagg acctgagcct 6caaa tatatcaaaa aacccgggca accggccaaa aaaattgcaa aagcctctcg cacaaa agacctattctagccatcaa ctttgtatcc gacgctgccg tttagctgcg ttgaag tcaagc atg gcg act act gag tcc tcg gcc ccg gcg gcc acc 232 Met Ala Thr Thr Glu Ser Ser Ala Pro Ala Ala Thr cc cag ccg gcc agc acc ccg ctg gcg aac tcg tcg ctg tac gtc ggt 28n Pro AlaSer Thr Pro Leu Ala Asn Ser Ser Leu Tyr Val Gly 5gac ctg gag aag gat gtc acc gag gcc cag ctg ttc gag ctc ttc tcc 328Asp Leu Glu Lys Asp Val Thr Glu Ala Gln Leu Phe Glu Leu Phe Ser 3tcg gtt ggc cct gtg gcc tcc att cgc gtg tgc cgc gat gcc gtcacg 376Ser Val Gly Pro Val Ala Ser Ile Arg Val Cys Arg Asp Ala Val Thr 45 5cgc cgc tcg ctg ggc tac gcc tac gtc aac tac aac agc gct ctg gac 424Arg Arg Ser Leu Gly Tyr Ala Tyr Val Asn Tyr Asn Ser Ala Leu Asp 65 7 cag gct gct gac cgc gcc atggag acc ctg aac tac cat gtc gtg 472Pro Gln Ala Ala Asp Arg Ala Met Glu Thr Leu Asn Tyr His Val Val 8aac ggc aag cct atg cgc atc atg tgg tcg cac cgc gac cct tcg gcc 52y Lys Pro Met Arg Ile Met Trp Ser His Arg Asp Pro Ser Ala 95 cgcaag tcg ggc gtc ggc aac atc ttc atc aag aac ctg gac aag acc 568Arg Lys Ser Gly Val Gly Asn Ile Phe Ile Lys Asn Leu Asp Lys Thr gac gcc aag gcc ctg cac gac acc ttc tcg gcc ttc ggc aag att 6sp Ala Lys Ala Leu His Asp Thr Phe Ser AlaPhe Gly Lys Ile ctg tcc tgc aag gtt gcc act gac gcc aac ggc gtg tcg aag ggc tac 664Leu Ser Cys Lys Val Ala Thr Asp Ala Asn Gly Val Ser Lys Gly Tyr ttc gtg cac ttc gag gac cag gcc gct gcc gat cgc gcc att cag 7he Val HisPhe Glu Asp Gln Ala Ala Ala Asp Arg Ala Ile Gln gtc aac cag aag aag att gag ggc aag atc gtg tac gtg gcc ccc 76l Asn Gln Lys Lys Ile Glu Gly Lys Ile Val Tyr Val Ala Pro cag aag cgc gct gac cgc ccc agg gca agg acg ttgtac acc aac 8ln Lys Arg Ala Asp Arg Pro Arg Ala Arg Thr Leu Tyr Thr Asn 2tc gtc aag aac ttg ccg gcc gac atc ggc gac gac gag ctg ggc 856Val Phe Val Lys Asn Leu Pro Ala Asp Ile Gly Asp Asp Glu Leu Gly22ag atg gcc acc gagcac ggc gag atc acc agc gcg gtg gtc atg aag 9et Ala Thr Glu His Gly Glu Ile Thr Ser Ala Val Val Met Lys 225 23c gac aag ggc ggc agc aag ggc ttc ggc ttc atc aac ttc aag gac 952Asp Asp Lys Gly Gly Ser Lys Gly Phe Gly Phe Ile Asn Phe Lys Asp245g tcg gcg gcc aag tgc gtg gag tac ctg aac gag cgc gag atg Glu Ser Ala Ala Lys Cys Val Glu Tyr Leu Asn Glu Arg Glu Met 255 26c ggc aag acc ctg tac gcc ggc cgc gcc cag aag aag acc gag cgc Gly Lys Thr Leu Tyr Ala GlyArg Ala Gln Lys Lys Thr Glu Arg 278g atg ctg cgc cag aag gcc gag gag agc aag cag gag cgt tac Ala Met Leu Arg Gln Lys Ala Glu Glu Ser Lys Gln Glu Arg Tyr285 29ag tac cag agc atg aac ctg tac gtc aag aac ctg tcc gac gag Lys Tyr Gln Ser Met Asn Leu Tyr Val Lys Asn Leu Ser Asp Glu 33tc gac gac gac gcc ctg cgt gag ctg ttc gcc aac tct ggc acc Val Asp Asp Asp Ala Leu Arg Glu Leu Phe Ala Asn Ser Gly Thr 323c tcg tgc aag gtc atg aaggac ggc agc ggc aag tcc aag ggc Thr Ser Cys Lys Val Met Lys Asp Gly Ser Gly Lys Ser Lys Gly 335 34c ggc ttc gtg tgc ttc acc agc cac gac gag gcc acc cgg ccg ccc Gly Phe Val Cys Phe Thr Ser His Asp Glu Ala Thr Arg Pro Pro 356c gag atg aac ggc aag atg gtc aag ggc aag ccc ctg tac gtg Thr Glu Met Asn Gly Lys Met Val Lys Gly Lys Pro Leu Tyr Val365 378g gcg cag cgc aag gac gtg cgc cgt gcc acc cag ctg gag gcc Leu Ala Gln Arg Lys Asp Val ArgArg Ala Thr Gln Leu Glu Ala 385 39c atg cag gcg cgc atg ggc atg ggc gcc atg agc cgc ccg ccg aac Met Gln Ala Arg Met Gly Met Gly Ala Met Ser Arg Pro Pro Asn 44tg gcc ggc atg agc ccc tac ccc ggc gcc atg ccg ttc ttc gct Met Ala Gly Met Ser Pro Tyr Pro Gly Ala Met Pro Phe Phe Ala 4425ccc ggc ccc ggc ggc atg gct gct ggc ccg cgc gct ccg ggc atg atg Gly Pro Gly Gly Met Ala Ala Gly Pro Arg Ala Pro Gly Met Met 434g ccc atg atg ccg ccg cgc ggc atgcct ggc ccc ggc cgc ggc Pro Pro Met Met Pro Pro Arg Gly Met Pro Gly Pro Gly Arg Gly445 456c ggc ccc atg atg ccg ccc cag atg atg ggt ggc ccc atg atg Arg Gly Pro Met Met Pro Pro Gln Met Met Gly Gly Pro Met Met 465 47cccg ccc atg ggc ccc ggg cgc ggc cgt ggc ggc cgc ggc ccc tcc Pro Pro Met Gly Pro Gly Arg Gly Arg Gly Gly Arg Gly Pro Ser 489c ggc cag ggc cgc ggc aac aac gcc cct gcc cag cag ccc aag Arg Gly Gln Gly Arg Gly Asn Asn Ala Pro AlaGln Gln Pro Lys 495 5cc gcc gct gag ccg gcc gcc gcg ccc gcc gcc gcc gcc ccc gct gcc Ala Ala Glu Pro Ala Ala Ala Pro Ala Ala Ala Ala Pro Ala Ala 552g cct gcc gcc gcg gcg gag ccg gag gcc ccc gcc gcc cag cag Ala Pro AlaAla Ala Ala Glu Pro Glu Ala Pro Ala Ala Gln Gln525 534g acc gcc tcc gcg ctg gcc gcc gcc gcg ccg gag cag cag aag Leu Thr Ala Ser Ala Leu Ala Ala Ala Ala Pro Glu Gln Gln Lys 545 55g atg atc ggc gag cgc ctg tac ccg cag gtg gcggag ctg cag ccc Met Ile Gly Glu Arg Leu Tyr Pro Gln Val Ala Glu Leu Gln Pro 567g gct ggc aag atc acc ggc atg ctg ctg gag atg gac aac gcc Leu Ala Gly Lys Ile Thr Gly Met Leu Leu Glu Met Asp Asn Ala 575 58g ctt ctg atgctt ctg gag tcg cac gag gcg ctg gtg tcc aag gtg 2Leu Leu Met Leu Leu Glu Ser His Glu Ala Leu Val Ser Lys Val 59ag gcc atc gct gtg ctc aag cag cac aac gtg att gcc gag gag 2Glu Ala Ile Ala Val Leu Lys Gln His Asn Val Ile Ala GluGlu66ac aag gct taaagcgcct gcacgcttgt gcgggctggt ggcgccggcg 2Lys Alacgcgccggcg ctgcttgggc cgccggcagc atgggcgcgg cggacgcggt gtgggagcag 2tgctgc ttctggccgc cgtgaagccg cgccgaactg gggcggacgg caggctggcg 2225ttgacgccgg cgcgccacaacacaaagttg gtggcgtgaa agtctctggg cgtgctccgg 2285acggttgtaa ggttttaaga actggctttt ggccgggttg ccgcccaaag gcggaacggc 2345ggtcttttca ggccaatcac atccggctgg aaaaattctt accaaagcca acccctgcac 24aattt cgggttccga aagaacactc cccttttttc cggcaacgcg ttctttcaag2465gccaatcact ttccgggttg gaagaaaatg ttacccggaa aaggcgggaa gccccctgca 2525cccggacaag ttattcgggg tttcgccggg aatgagcaag cgttcgggct gttggccgta 2585tcgcgaacgc tgtcggggtg tcaggcgcca gaaggaagga tgacgttttg gtgaaggggt 2645gcaaactgag cacacgagtt ttggcaatagacgtggagaa agtccagtgc ggggtgaggc 27gcgga atcaagcgtg gcgggtccct ggcgagacga gacgcttctg ttgttttgct 2765gagccctttg atggcacaat cgcactgttt tgagcaggcg actgtaaagt gcccgacgct 2825aaaaaagcgg ccgcgaattc c 28466lamydomonas reinhardtii 6Trp Phe Val AspGly Glu Leu Ala Ser Asp Tyr Asn Gly Pro Arg TChlamydomonas reinhardtii 7Gln Leu Ile Leu Trp Thr Thr Ala Asp Asp Leu Lys Ala Asp Ala Glu et Thr Val Phe Arg 2Artificial SequenceDescription of Artificial Sequenceoligonucleotide primer 8cgcggatccg aygcbgagat yatgac 26926DNAArtificial SequenceDescription of Artificial Sequence oligonucleotide primer 9cgcgaattcg tcatratctc vgcrtc 26NAChlamydomonas reinhardtiiCDS(6agtacgttt acgcc atg aac cgt tggaac ctt ctt gcc ctt acc ctg ggg 5sn Arg Trp Asn Leu Leu Ala Leu Thr Leu Gly tg ctg ctg gtg gca gcg ccc ttc acc aag cac cag ttt gct cat gct 99Leu Leu Leu Val Ala Ala Pro Phe Thr Lys His Gln Phe Ala His Ala 5tcc gat gag tat gag gac gacgag gag gac gat gcc ccc gcc gcc cct Asp Glu Tyr Glu Asp Asp Glu Glu Asp Asp Ala Pro Ala Ala Pro 3aag gac gac gac gtc gac gtt act gtg gtg acc gtc aag aac tgg gat Asp Asp Asp Val Asp Val Thr Val Val Thr Val Lys Asn Trp Asp 45 5gag acc gtc aag aag tcc aag ttc gcg ctt gtg gag ttc tac gct cct 243Glu Thr Val Lys Lys Ser Lys Phe Ala Leu Val Glu Phe Tyr Ala Pro 65 7 tgc ggc cac tgc aag acc ctc aag cct gag tac gct aag gct gcc 29s Gly His Cys Lys Thr Leu Lys Pro GluTyr Ala Lys Ala Ala 8acc gcc ctg aag gct gct gct ccc gat gcc ctt atc gcc aag gtc gac 339Thr Ala Leu Lys Ala Ala Ala Pro Asp Ala Leu Ile Ala Lys Val Asp 95 gcc acc cag gag gag tcc ctg gcc cag aag ttc ggc gtg cag ggc tac 387Ala Thr Gln GluGlu Ser Leu Ala Gln Lys Phe Gly Val Gln Gly Tyr acc ctc aag tgg ttc gtt gat ggc gag ctg gct tct gac tac aac 435Pro Thr Leu Lys Trp Phe Val Asp Gly Glu Leu Ala Ser Asp Tyr Asn ggc ccc cgc gac gct gat ggc att gtt ggc tgg gtgaag aag aag act 483Gly Pro Arg Asp Ala Asp Gly Ile Val Gly Trp Val Lys Lys Lys Thr ccc ccc gcc gtg acc gtt gag gac gcc gac aag ctg aag tcc ctg 53o Pro Ala Val Thr Val Glu Asp Ala Asp Lys Leu Lys Ser Leu gcg gac gctgag gtc gtt gtc gtc ggc tac ttc aag gcc ctg gag 579Glu Ala Asp Ala Glu Val Val Val Val Gly Tyr Phe Lys Ala Leu Glu gag atc tac gac acc ttc aag tcc tac gcc gcc aag acc gag gac 627Gly Glu Ile Tyr Asp Thr Phe Lys Ser Tyr Ala Ala Lys Thr GluAsp 2tg ttc gtg cag acc acc agc gcc gac gtc gcc aag gcc gcc ggc 675Val Val Phe Val Gln Thr Thr Ser Ala Asp Val Ala Lys Ala Ala Gly22tg gac gcc gtg gac acc gtg tcc gtg gtc aag aac ttc gcc ggt gag 723Leu Asp Ala Val Asp Thr ValSer Val Val Lys Asn Phe Ala Gly Glu 225 23c cgc gcc acc gcc gtc ctg gcc acg gac atc gac act gac tcc ctg 77g Ala Thr Ala Val Leu Ala Thr Asp Ile Asp Thr Asp Ser Leu 245g ttc gtc aag tcg gag aag atg ccc ccc acc att gag ttc aac8la Phe Val Lys Ser Glu Lys Met Pro Pro Thr Ile Glu Phe Asn 255 26g aag aac tct gac aag atc ttc aac agc ggc atc aac aag cag ctg 867Gln Lys Asn Ser Asp Lys Ile Phe Asn Ser Gly Ile Asn Lys Gln Leu 278g tgg acc acc gcc gac gacctg aag gcc gac gcc gag atc atg 9eu Trp Thr Thr Ala Asp Asp Leu Lys Ala Asp Ala Glu Ile Met285 29tg ttc cgc gag gcc agc aag aag ttc aag ggc cag ctg gtg ttc 963Thr Val Phe Arg Glu Ala Ser Lys Lys Phe Lys Gly Gln Leu Val Phe 33cc gtc aac aac gag ggc gac ggc gcc gac ccc gtc acc aac ttc Thr Val Asn Asn Glu Gly Asp Gly Ala Asp Pro Val Thr Asn Phe 323c ctc aag ggc gcc acc tcg cct gtg ctg ctg ggc ttc ttc atg Gly Leu Lys Gly Ala Thr Ser Pro ValLeu Leu Gly Phe Phe Met 335 34g aag aac aag aag ttc cgc atg gag ggc gag ttc acg gct gac aac Lys Asn Lys Lys Phe Arg Met Glu Gly Glu Phe Thr Ala Asp Asn 356t aag ttc gcc gag agc gtg gtg gac ggc acc gcg cag gcc gtg AlaLys Phe Ala Glu Ser Val Val Asp Gly Thr Ala Gln Ala Val365 378g tcg gag gcc atc ccc gag gac ccc tat gag gat ggc gtc tac Lys Ser Glu Ala Ile Pro Glu Asp Pro Tyr Glu Asp Gly Val Tyr 385 39g att gtg ggc aag acc gtg gag tct gtggtt ctg gac gag acc aag Ile Val Gly Lys Thr Val Glu Ser Val Val Leu Asp Glu Thr Lys 44tg ctg ctg gag gtg tac gcc ccc tgg tgc ggc cac tgc aag aag Val Leu Leu Glu Val Tyr Ala Pro Trp Cys Gly His Cys Lys Lys 4425ctg gagccc atc tac aag aag ctg gcc aag cgc ttt aag aag gtg gat Glu Pro Ile Tyr Lys Lys Leu Ala Lys Arg Phe Lys Lys Val Asp 434c atc atc gcc aag atg gat ggc act gag aac gag cac ccc gag Val Ile Ile Ala Lys Met Asp Gly Thr Glu Asn GluHis Pro Glu445 456g gtc aag ggc ttc cct acc atc ctg ttc tat ccc gcc ggc agc Glu Val Lys Gly Phe Pro Thr Ile Leu Phe Tyr Pro Ala Gly Ser 465 47c cgc acc ccc atc gtg ttc gag ggc ggc gac cgc tcg ctc aag tcc Arg Thr ProIle Val Phe Glu Gly Gly Asp Arg Ser Leu Lys Ser 489c aag ttc atc aag acc aac gcc aag atc ccg tac gag ctg ccc Thr Lys Phe Ile Lys Thr Asn Ala Lys Ile Pro Tyr Glu Leu Pro 495 5ag aag ggc tcc gac ggc gac gag ggc acc tcg gac gacaag gac aag Lys Gly Ser Asp Gly Asp Glu Gly Thr Ser Asp Asp Lys Asp Lys 552g tcc gac aag gac gag ctg taa gcggctatct gaactacccc Ala Ser Asp Lys Asp Glu Leu525 53ggag cgtctgcttg cgcgcttgcg cttgcacact gtgcatggatgggagttaag gagacgg agcacggagg ctgcgctcgg ttggtggctt ggagcaccgg cagcgcgtga gtcctgg cagcagcaac ggcggagcgg gcgcatattg gcgcgagctg gcgagcggct gctggag aggatatgct gccgggcggg aggaagggct aggggcagag atgagagcgt gggctgg catgcgggcgcccgtgcctc tccctgcggt gcagtccttg ctaggagacg ggttttg ccaaagaggg acgctgtcca cagccctgcg actggaagtt ttttaggccc ggtggta gtggtgttgg tacggttgtg tgcataagat gaacaacgtt tctctcaaga 2actact agtatgctga cggtgtgtgt atgtggtgga tggattgtgc cccgaccatg2gtgctg tgttgcctcg gcgcttctgt cgccctggat gtgcgtggtt ccgaacgctg 2catctg ttgaggagcg agggtgttgt cgggtccgcc cggcacggcc gcgtgatgtc 2234cggatgggga ttgcgagcga gggcaaccgc agcgcagata gcgccgcagc ggatcgagct 2294agcgcaggat gatgagagcc gggccttcgcggcgtgggat cagggaggag ccaaggcgga 2354gtgcatgcga ggaaaacagt gtgcggcaaa gaacgggctg caagaacgcc ttgcgcaaa 24TChlamydomonas reinhardtii ly His Cys Chlamydomonas reinhardtii sp Glu Leu DNAChlamydomonasreinhardtiiCDS(252)..(sc_feature(279)Codon also can encode Ser tattt taatactccg aaggaggcag ttggcaggca actgccactg acgtcccgta 6aggg gacgtccact ggcgtcccgt aaggggaagg ggacgtaggt acataaatgt ggtaac taacgtttga ttttttgtgg tataatatatgtaccatgct tttaatagaa gaattt ataaattaaa atatttttac aatattttac ggagaaatta aaactttaaa 24aaca t atg aca gca att tta gaa cgt cgt gaa aat tct agc cta 29hr Ala Ile Leu Glu Arg Arg Glu Asn Ser Ser Leu gg gct cgt ttt tgt gag tgg atcact tca act gaa aac cgt tta tac 338Trp Ala Arg Phe Cys Glu Trp Ile Thr Ser Thr Glu Asn Arg Leu Tyr 5atc ggt tgg ttc ggt gta atc atg

atc cca tgt ctt ctt act gca aca 386Ile Gly Trp Phe Gly Val Ile Met Ile Pro Cys Leu Leu Thr Ala Thr 3 45tca gta ttc atc atc gct ttc atc gct gct ccg cca gta gac atc gat 434Ser Val Phe Ile Ile Ala Phe Ile Ala Ala Pro Pro Val Asp Ile Asp 5ggt atc cgt gaa cca gtt tca ggt tct ctt ctt tac ggt aac aac atc 482Gly Ile Arg Glu Pro Val Ser Gly Ser Leu Leu Tyr Gly Asn Asn Ile 65 7 aca ggt gct gta atc cca act tct aac gca atc ggt ctt cac ttc 53r Gly Ala Val Ile Pro Thr Ser Asn AlaIle Gly Leu His Phe 8tac cca att tgg gaa gct gct tct cta gac gag tgg tta tac aac ggt 578Tyr Pro Ile Trp Glu Ala Ala Ser Leu Asp Glu Trp Leu Tyr Asn Gly 95 ggt cct tac caa ctt atc gtt tgt cac ttc ctt cta ggt gta tac tgc 626Gly Pro Tyr GlnLeu Ile Val Cys His Phe Leu Leu Gly Val Tyr Cys tac atg ggt cgt gag tgg gaa tta tct ttc cgt tta ggt atg cgt cca 674Tyr Met Gly Arg Glu Trp Glu Leu Ser Phe Arg Leu Gly Met Arg Pro atc gct gta gct tac tca gct cca gta gct gcagct tca gct gta 722Trp Ile Ala Val Ala Tyr Ser Ala Pro Val Ala Ala Ala Ser Ala Val tta gtt tac cct atc ggc caa ggt tca ttc tct gac ggt atg cct 77u Val Tyr Pro Ile Gly Gln Gly Ser Phe Ser Asp Gly Met Pro ggt atc tctggt act ttc aac ttc atg atc gta ttc caa gca gaa 8ly Ile Ser Gly Thr Phe Asn Phe Met Ile Val Phe Gln Ala Glu aac atc ctt atg cac cca ttc cac atg tta ggt gtt gct ggt gta 866His Asn Ile Leu Met His Pro Phe His Met Leu Gly Val Ala GlyVal 2tc ggt ggt tca tta ttc tca gct atg cac ggt tct tta gtt act tca 9ly Gly Ser Leu Phe Ser Ala Met His Gly Ser Leu Val Thr Ser 222a atc cgt gaa aca act gaa aac gaa tca gct aac gaa ggt tac 962Ser Leu Ile Arg Glu Thr ThrGlu Asn Glu Ser Ala Asn Glu Gly Tyr 225 23t ttc ggt caa gaa gaa gaa act tac aac att gta gct gct cat ggt Phe Gly Gln Glu Glu Glu Thr Tyr Asn Ile Val Ala Ala His Gly 245t ggt cgt cta atc ttc caa tac gct tct ttc aac aac tct cgt Phe Gly Arg Leu Ile Phe Gln Tyr Ala Ser Phe Asn Asn Ser Arg 255 26a tta cac ttc ttc tta gct gct tgg ccg gta atc ggt att tgg ttc Leu His Phe Phe Leu Ala Ala Trp Pro Val Ile Gly Ile Trp Phe278t gct tta ggt tta tca actatg gca ttc aac tta aac ggt ttc aac Ala Leu Gly Leu Ser Thr Met Ala Phe Asn Leu Asn Gly Phe Asn 29ac caa tca gta gta gac tca caa ggt cgt gta cta aac act tgg Asn Gln Ser Val Val Asp Ser Gln Gly Arg Val Leu Asn Thr Trp 33ac atc atc aac cgt gct aac tta ggt atg gaa gta atg cac gag Asp Ile Ile Asn Arg Ala Asn Leu Gly Met Glu Val Met His Glu 323c gct cac aac ttc cct cta gac tta gct tca act aac tct agc Asn Ala His Asn Phe Pro Leu Asp LeuAla Ser Thr Asn Ser Ser 335 34a aac aac taa ttttttttta aactaaaata aatctggtta accataccta Asn Asn35ttta gtttatacac acttttcata tatatatact taatagctac cataggcagt caggacg tccc 278DNAChlamydomonas reinhardtiiCDS(72)gc cat cat cat cat cat cat cat cat cat cac agc agc ggc cat 48Met Gly His His His His His His His His His His Ser Ser Gly His aa ggt cgt cat atg gcg act act gag tcc tcg gcc ccg gcg gcc 96Ile Glu Gly Arg His Met Ala Thr Thr Glu Ser SerAla Pro Ala Ala 2acc acc cag ccg gcc agc acc ccg ctg gcg aac tcg tcg ctg tac gtc Thr Gln Pro Ala Ser Thr Pro Leu Ala Asn Ser Ser Leu Tyr Val 35 4 gac ctg gag aag gat gtc acc gag gcc cag ctg ttc gag ctc ttc Asp Leu Glu Lys AspVal Thr Glu Ala Gln Leu Phe Glu Leu Phe 5tcc tcg gtt ggc cct gtg gcc tcc att cgc gtg tgc cgc gat gcc gtc 24r Val Gly Pro Val Ala Ser Ile Arg Val Cys Arg Asp Ala Val 65 7acg cgc cgc tcg ctg ggc tac gcc tac gtc aac tac aac agc gct ctg288Thr Arg Arg Ser Leu Gly Tyr Ala Tyr Val Asn Tyr Asn Ser Ala Leu 85 9 ccc cag gct gct gac cgc gcc atg gag acc ctg aac tac cat gtc 336Asp Pro Gln Ala Ala Asp Arg Ala Met Glu Thr Leu Asn Tyr His Val aac ggc aag cct atg cgc atc atgtgg tcg cac cgc gac cct tcg 384Val Asn Gly Lys Pro Met Arg Ile Met Trp Ser His Arg Asp Pro Ser cgc aag tcg ggc gtc ggc aac atc ttc atc aag aac ctg gac aag 432Ala Arg Lys Ser Gly Val Gly Asn Ile Phe Ile Lys Asn Leu Asp Lys atc gac gcc aag gcc ctg cac gac acc ttc tcg gcc ttc ggc aag 48e Asp Ala Lys Ala Leu His Asp Thr Phe Ser Ala Phe Gly Lys att ctg tcc tgc aag gtt gcc act gac gcc aac ggc gtg tcg aag ggc 528Ile Leu Ser Cys Lys Val Ala Thr Asp Ala AsnGly Val Ser Lys Gly ggc ttc gtg cac ttc gag gac cag gcc gct gcc gat cgc gcc att 576Tyr Gly Phe Val His Phe Glu Asp Gln Ala Ala Ala Asp Arg Ala Ile acc gtc aac cag aag aag att gag ggc aag atc gtg tac gtg gcc 624Gln Thr ValAsn Gln Lys Lys Ile Glu Gly Lys Ile Val Tyr Val Ala 2tc cag aag cgc gct gac cgc ccc agg gca agg acg ttg tac acc 672Pro Phe Gln Lys Arg Ala Asp Arg Pro Arg Ala Arg Thr Leu Tyr Thr 222g ttc gtc aag aac ttg ccg gcc gac atc ggcgac gac gag ctg 72l Phe Val Lys Asn Leu Pro Ala Asp Ile Gly Asp Asp Glu Leu225 234g atg gcc acc gag cac ggc gag atc acc agc gcg gtg gtc atg 768Gly Lys Met Ala Thr Glu His Gly Glu Ile Thr Ser Ala Val Val Met 245 25g gac gac aagggc ggc agc aag ggc ttc ggc ttc atc aac ttc aag 8sp Asp Lys Gly Gly Ser Lys Gly Phe Gly Phe Ile Asn Phe Lys 267c gag tcg gcg gcc aag tgc gtg gag tac ctg aac gag cgc gag 864Asp Ala Glu Ser Ala Ala Lys Cys Val Glu Tyr Leu Asn Glu ArgGlu 275 28g agc ggc aag acc ctg tac gcc ggc cgc gcc cag aag aag acc gag 9er Gly Lys Thr Leu Tyr Ala Gly Arg Ala Gln Lys Lys Thr Glu 29ag gcg atg ctg cgc cag aag gcc gag gag agc aag cag gag cgt 96u Ala Met Leu Arg GlnLys Ala Glu Glu Ser Lys Gln Glu Arg33ac ctg aag tac cag agc atg aac ctg tac gtc aag aac ctg tcc gac Leu Lys Tyr Gln Ser Met Asn Leu Tyr Val Lys Asn Leu Ser Asp 325 33g gag gtc gac gac gac gcc ctg cgt gag ctg ttc gcc aac tctggc Glu Val Asp Asp Asp Ala Leu Arg Glu Leu Phe Ala Asn Ser Gly 345c acc tcg tgc aag gtc atg aag gac ggc agc ggc aag tcc aag Ile Thr Ser Cys Lys Val Met Lys Asp Gly Ser Gly Lys Ser Lys 355 36c ttc ggc ttc gtg tgc ttcacc agc cac gac gag gcc acc cgg ccg Phe Gly Phe Val Cys Phe Thr Ser His Asp Glu Ala Thr Arg Pro 378g acc gag atg aac ggc aag atg gtc aag ggc aag ccc ctg tac Val Thr Glu Met Asn Gly Lys Met Val Lys Gly Lys Pro Leu Tyr385 39cc ctg gcg cag cgc aag gac gtg cgc cgt gcc acc cag ctg gag Ala Leu Ala Gln Arg Lys Asp Val Arg Arg Ala Thr Gln Leu Glu 44ac atg cag gcg cgc atg taa ggatcc Asn Met Gln Ala Arg Met 42BR>
* * * * *
 
 
  Recently Added Patents
Image processing method and apparatus thereof
Disposable insert, and use thereof in a method for manufacturing an airfoil
Systems and methods for adding information to a directory stored in a mobile device
Extrusion process for forming chemically stable drug multiparticulates
Diaphragm and loudspeaker using same
Adapter assembly for a fluid supply assembly
Body for an actuatable holding system
  Randomly Featured Patents
Process for homogenizing essentially immiscible liquids for forming an emulsion
Rifle with realistic cocking and firing sound
Organic electroluminescent element
Intermediates for specific 5-HT3 antagonists
Cacheable interface control registers for high speed data transfer
Method of manufacturing a product of one-piece construction wherein silicone rubber has been made to adhere
Process and device for preventing the engagement of an impermissible speed in an automated gearbox
Oval lighted address plaque
Fuel injection valve controller apparatus
Tough polyblends with improved heat distortion resistance