 |
|
 |
| |
 |
Sucrose phosphate synthase (SPS), its process for preparation its cDNA, and utilization of cDNA to modify the expression of SPS in plant cells |
| RE38446 |
Sucrose phosphate synthase (SPS), its process for preparation its cDNA, and utilization of cDNA to modify the expression of SPS in plant cells
|
|
| Patent Drawings: | |
| Inventor: |
Van Assche, et al. |
| Date Issued: |
February 24, 2004 |
| Application: |
09/393,941 |
| Filed: |
September 9, 1999 |
| Inventors: |
Bruneau; Jean Michel (Paris, FR) Gervais; Monica (Saint-Leu-la-Foret, FR) Lando; Danielle (Paris, FR) Van Assche; Charles (Saint Cyr sur Mer, FR) Voelker; Toni Alois (Davis, CA)
|
| Assignee: |
Calgene, LLC. (Davis, CA) |
| Primary Examiner: |
Nelson; Amy J. |
| Assistant Examiner: |
|
| Attorney Or Agent: |
Rae-Venter; Barbara Rae-Venter Law Group |
| U.S. Class: |
435/320.1; 435/411; 435/419; 435/468; 536/23.2; 536/23.6; 800/284; 800/317.4 |
| Field Of Search: |
; 435/69.1; 435/320.1; 435/468; 536/23.2; 536/23.6; 800/278; 800/284; 800/298; 800/317.4 |
| International Class: |
|
| U.S Patent Documents: |
5665892 |
| Foreign Patent Documents: |
90402084.9 |
| Other References: |
Sonnewald et al. Planta 189: 174-181, 1993.*. Kalt-Torres et al. Physiol. Plant. 70: 653-658,1987.*. Von Schaewen et al. EMBO J. 9: 3033-3044, 1993.*. Boswell et al. In Computational Molecular Biology Sources and Methods for Sequence Analysis (Lesk, ed.) Oxford University Press, Oxford, 1988, pp. 170-171.*. American Heritage Dictionary, second college edition, Houghton Mifflin Co., Boston, 1982, p. 1340.*. Kalt-Torres et al. (1987) Physiol, Plantarum 70: 653-658.*. Lee et al. (1988) Science 239: 1288-1291.*. Dickinson et al. (Feb. 1991) Plant Physiol. 95: 420-425.*. von Schaewen et al. (1990) The EMBO J. 9: 3033-3044.*. Sonnewald et al. (1993) Plant 189: 174-181.*. Werr et al. (1985) EMBO J. 4: 1373-1380.*. W. Kalt-Torres, et al., "Isolation and characterization of multiple forms of maize leaf sucrose-phosphate synthase," Physiol. Plantarum (1987) 70:653-658.. Kerr, et al. "Resolution of two molecular forms of sucrose-phosphate synthase from maize, soybean and spinach leaves," Planta (1987) 170:515-519.. Su, et al. "Purification and Properties of Sucrose Synthase from Maize Kernels," Plant Physiology (1978) 61(3): 389-393.. Bruneau, et al. "Sucrose Phosphate Synthase, a Key Enzyme for Sucrose Biosynthesis in Plants," Plant Physiol. (1991) 43-478.. |
|
| Abstract: |
Sucrose phosphate synthase (SPS), its process for preparation, its cDNA, and utilization of cDNA to modify the expression of SPS in the plant cells are provided. |
| Claim: |
We claim:
1. An isolated DNA encoding a sucrose phosphate synthase (SPS) derived from corn.
2. The DNA of claim 1 comprising the SPS encoding region shown in FIG. 7.
3. The DNA of claim 1 comprising cDNA.
4. The DNA of claim 1 comprising genomic DNA.
5. The DNA of claim 1 as present in a recombinant construct, wherein said DNA encoding a sucrose phosphate synthase is operably linked to a second DNA which is not naturally linked to said DNA encoding a sucrose phosphate synthase.
6. A recombinant construct comprising, as operably linked components in the 5' to 3' direction of transcription, a transcription initiation region functional in a vegetal cell and a DNA encoding a sucrose phosphate synthase (SPS) derived fromcorn.
7. The construct of claim 6 wherein said DNA encoding an SPS encodes a biologically active SPS.
8. The construct of claim 7 wherein said DNA encoding an SPS is in a sense orientation as to said transcription initiation region.
9. The construct of claim 8 further comprising a translation initiation region operably linked 3' to said transcription initiation region and 5' to said DNA encoding an SPS, wherein said translation initiation region is functional in a vegetalcell, and a transcription termination region functional in said vegetal cell 3' to said DNA encoding an SPS.
10. The construct of claim 9 wherein said transcription termination region is an SPS gene transcription termination region.
11. The construct of claim 6 wherein said DNA encoding an SPS comprises the SPS encoding region shown in FIG. 7.
12. The construct of claim 6 wherein said transcription initiation region is tissue specific.
13. The construct of claim 12 wherein said transcription initiation region is leaf specific.
14. A method of modifying the starch and sucrose levels in a tomato vegetal cell, said method comprising: growing a tomato vegetal cell having integrated into its genome a construct comprising, as operably linked components in the 5' to 3'direction of transcription, a transcription initiation region functional in said tomato vegetal cell and a DNA encoding a sucrose phosphate synthase derived from corn, wherein said DNA encoding said sucrose phosphate synthase derived from corn is notnaturally linked to said transcription initiation region, wherein said tomato vegetal cell is grown under conditions which permit said transcription initiation region to function, and wherein growing said tomato vegetal cell under said conditions permitssaid DNA encoding said sucrose phosphate synthase derived from corn to be expressed at a level which modifies the starch and sucrose levels in said tomato vegetal cell from a given ratio of starch to sucrose, as measured in control plant cells, to adifferent ratio of starch to sucrose.
15. The method of claim 14 where said tomato vegetal cell is a leaf cell.
16. A tomato vegetal cell having integrated into its genome a recombinant construct of any one of claims 6-13, 60-61 and 64-65.
17. A tomato plant comprising cells having integrated into its genome a recombinant construct of any one of claims 6-13, 60-61 and 64-65.
18. A tomato vegetal cell having a modified ratio of starch to sucrose, wherein said cell is produced according to the method comprising growing a tomato vegetal cell having integrated into its genome a construct of any one of claims 6-13 underconditions which permit said transcription initiation region to function, and wherein growing said vegetal cell under said conditions permit said construct to be expressed at a level which modifies the starch and sucrose levels in said vegetal cell,whereby the ratio of starch to sucrose level in said tomato vegetal cell is modified as compared to a given ratio of starch to sucrose measured in control plant cells.
19. A plant produced from a tomato vegetal cell of claim 18.
20. The method of claim 14, wherein said DNA encoding a sucrose phosphate synthase derived from corn is in a sense orientation as to said transcription initiation region.
21. The method of claim 20 wherein said construct further comprises a translation initiation region functional in a tomato vegetal cell operably linked 3' to said transcription initiation region and 5' to said DNA encoding, said sucrosephosphate synthase derived from corn and a transcription termination region functional in said tomato vegetal cell operably linked 3' to said DNA encoding said sucrose phosphate synthase derived from corn.
22. The method of claim 14 wherein said transcription initiation region is tissue specific.
23. The method of claim 22 wherein said transcription initiation region is leaf specific.
24. A tomato vegetal cell having modified levels of starch and sucrose, wherein said modified levels of starch and sucrose are produced according to the method of claim 14.
25. A method of increasing the yield of a tomato plant comprising: growing a plant, wherein the genome of said plant comprises an integrated chimeric DNA construct capable of providing for expression of sucrose phosphate synthase derived fromcorn at a level sufficient to increase the amount of sucrose in tomato fruit by a factor of about 2 and decrease the amount of leaf starch by about 50% as compared to the amount of sucrose and starch measured in a control tomato plant, whereby anincrease in plant yield is obtained.
26. An isolated DNA encoding a sucrose phosphate synthase wherein said DNA comprises at least about 10 nucleotides up to the full length of nucleotides represented by SEQ ID NO: 6.
27. The DNA sequence according to claim 26, wherein said DNA sequence encodes an amino acid sequence represented by a SEQ ID NO selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.
28. The DNA of claim 26 comprising cDNA.
29. The DNA of claim 26 comprising genomic DNA.
30. The isolated DNA encoding a sucrose phosphate synthase according to claim 26 as present in a recombinant construct, wherein said DNA encoding a sucrose phosphate synthase is operably linked to a second DNA which is not naturally linked tosaid DNA encoding a sucrose phosphate synthase.
31. A recombinant construct comprising, as operably linked components in the 5' to 3' direction of transcription, a transcription initiation region functional in a tomato vegetal cell and said DNA encoding a sucrose phosphate synthase accordingto claim 26.
32. The construct of claim 31 wherein said DNA encoding a sucrose phosphate synthase encodes a biologically active sucrose phosphate synthase.
33. The construct of claim 32 wherein said DNA encoding a sucrose phosphate synthase is in a sense orientation as to said transcription initiation region.
34. The construct of claim 33 further comprising a translation initiation region operably linked 3' to said transcription initiation region and 5' to said DNA encoding a sucrose phosphate synthase, wherein said translation initiation region isfunctional in a tomato vegetal cell, and a transcription termination region functional in said vegetal cell 3' to said DNA encoding an SPS.
35. The construct of claim 34 wherein said transcription termination region is a sucrose phosphate synthase gene transcription termination region.
36. The construct of claim 31 wherein said transcription initiation region is tissue specific.
37. The construct of claim 36 wherein said transcription initiation region is leaf specific.
38. A nucleic acid sequence encoding a peptide wherein said peptide has an amino acid sequence represented by a SEQ ID. NO: selected from the group consisting of SEQ ID. NO: 1, SEQ ID. NO: 2, SEQ ID. NO: 3, SEQ ID. NO: 4, and SEQ ID. NO:5.
39. A tomato vegetal cell having integrated into its genome a recombinant construct according to claim 30.
40. A leaf cell having integrated into its genome a recombinant construct according to claim 30.
41. A tomato plant comprising cells according to claims 39 or 40.
42. A tomato vegetal cell having a modified ratio of starch to sucrose, wherein said cell is produced according to the method comprising growing a tomato vegetal cell having integrated into its genome a construct according to claim 30 underconditions which permit said transcription initiation region to function, and wherein growing said tomato vegetal cell under said conditions permit said construct to be expressed at a level which modifies the starch and sucrose levels in said tomatovegetal cell, whereby the ratio of starch to sucrose level in said tomato vegetal cell is modified as compared to a given ratio of starch to sucrose measured in control plant cells.
43. A tomato plant produced from a tomato vegetal cell of claim 42.
44. A method of increasing the yield of a tomato plant sink tissue, said method comprising: growing a tomato plant having integrated into its genome a construct comprising, as operably linked components in the 5' to 3' direction oftranscription, a transcription initiation region functional in a tomato plant cell and a DNA encoding a sucrose phosphate synthase derived from corn, wherein said DNA encoding a sucrose phosphate synthase is not naturally linked to said transcriptioninitiation region, and wherein said tomato plant cell is grown under conditions which permit said transcription initiation region to function, whereby the amount of sucrose available to said tomato plant sink tissue is increased compared to the amount ofsucrose measured in a control tomato plant sink tissue.
45. The method of claim 44 wherein said transcription initiation region is tissue specific.
46. The method of claim 45 wherein said transcription initiation region is functional in a fruit cell.
47. The method of claim 45 wherein said transcription initiation region is functional in a leaf cell.
48. The method of claim 47 wherein said transcription initiation region is a Rubisco small subunit promoter.
49. The method of claim 44, wherein increasing the amount of sucrose available in tomato plant sink tissue increases the amount of total solids per unit weight of said sink tissue compared to the amount of total solids per unit weight measuredin a control tomato plant sink tissue.
50. The method of claim 44 wherein said sink tissue is fruit tissue.
51. The method of claim 40, wherein said weight is dry weight.
52. A method of increasing the amount of soluble solids in a tomato plant sink tissue, said method comprising: growing a tomato plant having integrated into its genome a construct comprising, as operably linked components in the 5' to 3'direction of transcription, a transcription initiation region functional in a tomato plant cell and a DNA encoding a sucrose phosphate synthase derived from corn, wherein said DNA encoding a sucrose phosphate synthase is not naturally linked to saidtranscription initiation region, and wherein said tomato plant cell is grown under conditions which will permit said transcription initiation region to function, whereby the amount of soluble solids per unit weight of said tomato plant sink tissue isincreased compared to the amount of solids measured in a control plant sink tissue; and whereby starch is converted to sucrose in said tomato plant cell and whereby an increased level of sucrose is made available to said tomato plant sink tissue.
53. The method of claim 52 wherein said transcription initiation region is tissue specific.
54. The method of claim 53 wherein said transcription initiation region is functional in a tomato fruit cell.
55. The method of claim 53 wherein said transcription initiation region is functional in a tomato leaf cell and wherein said sucrose is transported into said sink tissue.
56. The method of claim 55 wherein said transcription initiation region is a Rubisco small subunit promoter.
57. The method of claim 52 wherein said sink tissue is fruit tissue.
58. The method of claim 52 wherein the amount of sucrose in said tomato plant sink tissue is increased compared to the amount of sucrose measured a control tomato plant sink tissue.
59. The method of claim 52 wherein the amount of glucose and fructose in said sink tissue is increased compared to the amount of glucose and fructose measured in a control tomato plant sink tissue.
60. The construct of claim 6 wherein said transcription initiation region is a cauliflower mosaic virus 35S promoter region.
61. The construct of claim 13 wherein said transcription initiation region is a Rubisco small subunit promoter region.
62. The method of claim 14 wherein said transcription limitation region is a cauliflower mosaic virus 35S promoter region.
63. The method of claim 23 wherein said transcription limitation region is a Rubisco small subunit promoter region.
64. The construct of claim 31 wherein said transcription initiation region is a cauliflower mosaic virus 35S promoter region.
65. The construct of claim 37 wherein said transcription initiation region is a Rubisco small subunit promoter region.
66. The method of claim 44 wherein said transcription initiation region is a cauliflower mosaic virus 35S promoter region.
67. The method of claim 52 wherein said transcription initiation region is a cauliflower mosaic virus 35S promoter region..Iadd.
68. A recombinant construct comprising, as operably linked components in the 5' to 3' direction of transcription, a transcription initiation region functional in a vegetal cell and the DNA encoding a sucrose phosphate synthase according to claim26. .Iaddend..Iadd.
69. The recombinant construct according to claim 68, wherein said DNA encoding a sucrose phosphate synthase encodes a biologically active sucrose phosphate synthase. .Iaddend..Iadd.
70. The recombinant construct according to claim 69, wherein said DNA encoding a sucrose phosphate synthase is in a sense orientation as to said transcription initiation region. .Iaddend..Iadd.
71. The recombinant construct according to claim 70, further comprising a translation initiation region operably linked 3' to said transcription initiation region and 5' to said DNA encoding a sucrose phosphate synthase, and a transcriptiontermination region functional in said vegetal cell 3' to said DNA encoding a sucrose phosphate synthase. .Iaddend..Iadd.
72. The recombinant construct according to claim 71, wherein said transcription termination region is a sucrose phosphate synthase gene transcription termination region. .Iaddend..Iadd.
73. The recombinant construct according to claim 68, wherein said transcription initiation region is tissue specific. .Iaddend..Iadd.
74. The recombinant construct according to claim 68, wherein said transcription initiation region is leaf specific. .Iaddend..Iadd.
75. The recombinant construct according to claim 68, wherein said transcription initiation region is a cauliflower mosaic virus 35S promoter region. .Iaddend..Iadd.
76. The recombinant construct according to claim 74, wherein said transcription initiation region is a Rubisco small subunit promoter region. .Iaddend. |
| Description: |
The present invention relatesto the sucrose phosphate synthase (SPS), its process for preparation, its cDNA, and utilization of cDNA to modify the expression of SPS in the plant cells.
Difficulties in the purification of sucrose phosphate synthase (SPS) from plants have interferred with efforts to characterize this enzyme. SPS catalyses the formation of sucrose phosphate, the sucrose precursor molecule, from fructose-6phosphate and UDP-glucose in photosynthetically active plant cells. Sucrose phosphatase then acts on the sucrose phosphate moiety, in an irreversible reaction, to remove the phosphate and to release sucrose ready to translocate from the mature leaf(source) to any tissue requiring photoassimilate (sink), especially growing tissues including young leaves, seeds, and roots.
Because SPS is considered a rate limiting enzyme in the pathway providing sucrose to growing tissue, the study of SPS and its activity is of special interest. In a recent publication, Walker, J. L. & Huber, S. C., Plant Phys. (1989) 89 :518-524, the purification and preliminary characterization of spinach (Spinachia oleracea) SPS was reported. However, monoclonal antibodies specific to the spinach SPS were found to be non-reactive with all other plants tested, "closely related" and"relatively unrelated species", including corn (Zea maize), soybean (Glycine max), barley (Hordeum vulgare), and sugar beet (Beta vulgaris). Thus, additional purified sources of SPS enzyme are needed for effective characterization of this factor. Especially of interest is the characterization of the corn SPS because of its very high export rates, as compared for example, to SPS levels of activity as found in the leaves of soybean.
With the advent of biotechnology, the ability to modify various properties of plants, especially agronomically important crops, is of interest. In this regard, it would be useful to determine the coding sequence for an SPS gene to probe othercrop sources, to use such coding sequences to prepare DNA expression constructs capable of directing the expression of the SPS gene in a plant cell and to express a DNA sequence encoding an SPS enzyme in a plant to measure the effects on crop yield dueto the increased rate of sucrose translocation to growing tissues.
DETAILED DESCRIPTION OF THE FIGURES
FIG. 1 shows an SDS-PAGE profile at various stages of SPS purification and the quality of the final preparation. See Section 1.2.7 for Key to FIG. 1.
FIG. 2 shows the results of a Western analysis of SPS using monoclonal antibodies. See Section 3.1 for Key to FIG. 2.
FIG. 3 shows peptide sequences (SEQ ID NOS: 1-5) derived from the SPS protein: peptide A8 (SEQ ID NO:1), B4 (SEQ ID NO: 2) and B11 (SEQ ID NO: 3) correspond to the SPS 90 kilodalton (kd) protein; peptides 4K (SEQ ID NO: 4) and 12N (SEQ ID NO: 5)correspond to the SPS 30 kd protein. All peptides are typed N.fwdarw.C terminal.
FIG. 4 shows the oligonucleotides used for the PCR reactions CD3 (11C (SEQ ID NO: 9) and 4K3 (SEQ ID NO: 10)) and CD4 (11B (SEQ ID NO: 11) and 4K1S (SEQ ID NO: 12)) in relation to the B11 (SEQ ID NO: 3) and 4K (SEQ ID NO: 4) peptides (antisensesequences are presented upside down). Arrows point to the direction the oligonucleotides will prime the polymerase.
FIG. 5A shows the results of an agarose gel electrophoresis of CD3 and CD4 PCR reactions. The sizes are given in kb, where M=molecular size marker in kilobase pairs (kb). FIG. 5B shows an autoradiograph of Southern blot of CD3 and CD4 PCRreactions probed with oligonucleotide 4K5 (SEQ ID NO: 13), where M=molecular size marker in kb.
FIG. 6 shows schematic diagrams representing SPS cDNA and selected clones SPS#3, SPS#18, SPS#61, SPS#77 and SPS#90. The upper bar represents the entire 3509 bp combined map and selected restriction sties. The translation stop and start codonsare indicated.
FIG. 7 shows the assembled SPS cDNA sequence and selected restriction sites. The sequences of clones SPS#90, SPS#61 and SPS#3 were fused at the points indicated in FIG. 6. The SPS reading frame is translated. All SPS protein derived peptidesequences are indicated.
FIG. 8 shows Western blots showing characteristics of rabbit SPS 90 and SPS 30 antisera. Lanes T=total protein extract from corn leaf; Lanes S=immunopurified SPS; Panel CBB=Coomassie Blue-stained protein; pAS**=preimmune serum, SPS 30 rabbit;AS**=immune serum anti SPS 30; pAS*=preimmune serum, SPS 90 rabbit; AS*=immune serum anti SPS 90. Molecular weight markers at left, where indicated; S=SPS 120 kilodalton (kd) polypeptide; S*=SPS 90 kd polypeptide; S**=SPS 30 kd polypeptide.
FIG. 9A shows a Coomassie Blue-stained gel of total protein isolated from a 30 day old corn plant. M=size marker in kilodaltons (kd); R=roots; 1-8=leaf numbers counting from the bottom of the plant. Leaf 5 has been cut into 5 segments from theleaf tip (5a) to the end of the sheath (5e). PEP=phosphoenolpyruvate carboxylase.
FIG. 9B shows the results of Western blot analysis of a replicate of the gel shown in FIG. 9A using a mixture of anti SPS 30 and anti SPS 90 antisera against total plant protein isolated from a 30 day old corn plant. The signal corresponding toSPS appears at 120-140 kd.
In a first embodiment, proteins having the sucrose phosphate synthase (SPS) activity, namely, a protein capable of catalyzing the formation of sucrose phosphate from fructose-6-phosphate and UDP-glucose substrates, areprovided. Among the preferred proteins of this invention are such proteins obtainable from corn which are substantially free of other proteins.
By "protein" is meant any amino acid sequence, including a protein, polypeptide, or peptide fragment, whether obtained from plant or synthetic sources, which demonstrates the ability to catalyze the formation of sucrose phosphate. An SPS of thisinvention will include sequences which are modified, such as sequence which have been mutated, truncated, increased, contain codon substitutions as a result of the degeneracy of the DNA code, and the like as well as sequences which are partially orwholly artificially synthesized, so long as the synthetic sequence retains the characteristic SPS activity.
By "substantially free from other proteins" is meant that the protein has been partially purified away from proteins found in the plant cell. Such a protein of this invention will demonstrate a specific enzymatic activity of at least greaterthan 0,05, more preferably at least greater than at least 0,30, wherein specific enzymatic activity (sA) is measured in units which correspond to 1 .mu.m (micromole) of sucrose formed per minute per mg of protein at 37.degree. C. In a more preferredembodiment, the protein will demonstrate even more improved sA and increased purification factors (see, Table 1).
The invention relates to the enzyme comprising a corn SPS having a molecular weight from about 110 to 130 kilodalton (kd) and a specific activity of greater than 0,05 U.
The invention relates more particularly to the enzyme comprising a corn SPS having a specific activity of about 25 U.
In order to obtain the nucleic acid sequences encoding the SPS, especially corn SPS, substantially purified SPS was required. As demonstrated more fully in the examples, corn SPS purified 500-fold was obtained in small quantities which were thenultimately used to obtain peptide sequence which in turn led to the determination of the cDNA sequence.
Among the preferred proteins of the invention are the proteins having the above definition with a molecular weight from about 110 to about 130 kd, having the form of a monomer, a dimer or a tetramer and their derivatives, comprising at least onepeptide having the following amino acid sequence: Thr-Trp-Ile-Lys (SEQ ID NO: 1) Tyr-Val-Val-Glu-Leu-Ala-Arg (SEQ ID NO: 2) Ser-Met-Pro-Pro-Ile-Trp-Ala-Glu-Val-Met-Arg (SEQ ID NO: 5) Leu-Arg-Pro-Asp-Gln-Asp-Tyr-Leu-Met-His-Ile-Ser-His-Arg (SEQ ID NO: 4)Trp-Ser-His-Asp-Gly-Ala-Arg (SEQ ID NO: 5)
The invention also relates to a process to prepare proteins as above defined, characterized in that: a) one extracts from parts containing SPS, preserved at low temperature, by grinding, centrifugation and filtration, b) one increases the SPSrate of the extract so obtained by precipitation in an appropriate solvent, centrifugation and solubilization of the precipitate in a buffer solution. c) one purifies the protein so obtained by chromatography and if desired, d) one prepares thehybridomas, and monoclonal antibodies from an antigenic solution prepared from one of the preparations a, b, c, e) one screens the hybridomas and raises monoclonal antibodies specifically directed against SPS, f) one purifies the SPS so obtained with themonoclonal antibodies bodies so prepared.
The invention more precisely relates to a process of preparation of corn SPS characterized in that: a) one extracts from part of corn plants by grinding centrifugation and filtration, b) one increases the SPS rate of the extract so obtained byprecipitation in polyethyleneglycol (PEG), centrifugation and solubilization of the precipitate obtained in a buffer solution, c) one purifies the protein obtained in low pressure anion exchange chromatography and in chromatography on heparin sepharose,then in anion exchange high performance chromatography, d) one purifies the active pools by passage on 2 high performance chromatography columns, and if desired, e) one prepares the hybridomas and monoclonal antibodies from an antigenic solution preparedfrom one preparation a, b, c, f) one screens the hybridomas and raises the monoclonal antibodies specifically directed against SPS, g) one purifies the SPS preparation with the monoclonal antibodies so obtained.
Preferably, - corn is a corn Pioneer corn hybrid strain 3184, - part of plants are leaves kept at low temperature by example between -50.degree. C. and -90.degree. C., - purification in the polyethyleneglycol is realized
. first by precipitating at a final concentration in PEG about 6%,
. then by precipitating at a final concentration about 12%. The different chromatographies are realized in the following way: 1st chromatography DEAE sepharose 2nd chromatography heparin sepharose: at this stage, the preparation obtained may bekept several days without loss of activity 3rd chromatography Mono q chromatography 4th chromatography HPLC hydroxyapatite 5th chromatography HPLC hydroxyapatite. - during the different steps of purification and thereafter, the SPS activity may bemeasured according to two methods, a) a method based on a colorimetric test or resorcinol test, b) a method based on the dosage of one of the products formed during the transformation reaction where SPS is involved.
Both methods are detailed in the experimental part detailed hereunder.
Mice are immunized with several injections of enzymatic preparations.
Different kinds of mice may be used, for example BALB/c.
The antigen may be used in completed Freund adjuvant then in incompleted Freund adjuvant. Several injections in mice are realized: good results have been obtained with three injections of Mono q, pools, followed by three injections of finalpools (days 0, 14, 27, 60, 90 and 105 for example).
The first injections are administered sub-cutaneously, for example in the cushions, and the feet, the last injection is administered intravenously in the tail for example. - the preparation of spleen cellular suspensions so immunized is made ina conventional way.
The steps of fusion with myelona cells, of conservation of the hybridoma, of cloning, of antibodies production are made by conventional ways.
To detect the hybridoma secreting the monoclonal antibodies raised against the antigen, two methods are used to select antibodies:
. a method of detection of antibodies as inhibitor of SPS activity,
. a method of detection of antibodies precipitating SPS activities.
In a preferred embodiment, these methods are the methods described in the experimental section detailed hereunder.
Among the objects of the invention, are also provided lines of hybridoma cells, and in particular hybridoma cells described as:
SPA 2-2-3:I-971 SPB 3-2-19:I-973 SPA 2-2-22:I-970 SPB 5-2-10:I-974 SPA 2-2-25:I-972 SPB 5-4-2:I-975 SPB 13-1-7:I-976 SPB 13-2-2:I-977
a deposit of which has been made at the C.N.C.M. (INSTITUT PASTEUR PARIS) on Jun. 11, 1990.
The invention relates also to monoclonal antibodies specifically directed against SPS.
The invention relates also to a process of preparation of proteins as defined above characterized in that a preparation containing the socalled proteins is purified on a chromatography column having monoclonal antibodies as defined abovespecifically raised against the proteins.
The invention relates also to cDNA coding for proteins as defined above, specifically cDNA coding for corn SPS. Among the preferred cDNA preferred is the cDNA with the following nucleotide sequence (SEQ ID NO: 6) represented in FIG. 7A throughFIG. 7J.
Thus, this invention relates to an extrachromosomal DNA sequence encoding a SPS as defined above. Any DNA sequence which is not incorporated into the genome of a plant is considered extrachromosomal, i.e., outside of the chromosome, for purposesof this invention. This includes, but is not limited to cDNA, genomic DNA, truncated sequences, single stranded and double stranded DNA. In a preferred embodiment, the DNA sequence is cDNA. In a different preferred embodiment, the DNA sequence isobtainable from corn.
Among the preferred proteins and nucleic acid sequences of the invention is corn SPS. The corn SPS is represented in FIG. 1, which shows the presence of proteins at about 120, 95 and 30 kd. The proteins shown at 95 and 30 kd are considered tobe breakdown products of the protein shown at 120 kd. The complete protein is believed to a a di- or tetrameric protein having as the basic sub-unit from about a 110 to about 130 kd protein. The complete cDNA sequence (SEQ ID NO: 6) of the corn SPS isshown in FIG. 7.
cDNA coding for sucrose phosphate synthase has been prepared in the following way. 1) Sequencing of peptide fragments from purified SPS.
With the purified preparations of SPS previously obtained, by separating on acrylamide gel, a 120 kd minor band (corresponding to the total protein sequence) and two 90 kd and 30 kd major bands are obtained. Both major polypeptides are separatedon electrophoresis and electroeluted. By a trypsin digestion and the sequencing of fragments so obtained, the sequence of 5 peptides has been determined.
This aminoacid sequence allows to determine the corresponding degenerate nucleotide sequence. 2) Corn leaf isolation.
Total RNA is isolated according to TURPEN and GRIFFITH (1986, Biotechniques vol. 4 pages 11-15) for poly(A) RNA preparation, the standard oligo dT cellulose column was used. 3) cDNA library construction.
cDNA synthesis is realized by following the protocol of a kit supplied by PROMEGA except that M-MLV reverse transcriptase is used instead of AMV reverse transcriptase. The length of cDNA obtained is from 500 to several thousand base pairs. Oneadds ECORI linkers to the blunt ended cDNA and clones this material into a second generation lambda GT11 expression vector. Total library size is about 1,5.10.sup.6 plaques. 4) Utilization of PCR in order to synthesize a nucleotide sequence specificfor SPS.
The oligonucleotides derived from peptides B11 (SEQ ID NO: 3) (SPS 30 kd) and 4K (SEQ ID NO: 4) (90 kd) described in FIG. 3 are used as primers in a PCR reaction. It has been assumed that peptides derived from SPS 30 and SPS 90 are degradationproducts of protein SPS 120 kd, and that, peptides derived from SPS and SPS 90 are encoded by the same RNA.
With this hypothesis, by using in proper polarity pairs of oligonucleotides corresponding to the peptidic sequences in a PCR reaction, one may obtain the synthesis of the DNA, connecting the two location. Since it is a priori not known in whichorder the peptides are located relative to each other, one has to do the two different possibilities FIG. 4. Only the oligonucleotide couple CD3 synthesizes a cDNA of defined length (1200 bp) (FIG. 5A and FIG. 5B). 5) cDNA library screening.
When 250000 lambda clones GT11 are screened using the 1200 bp long PCR cDNA, 16 positives are obtained. Sizes of the inserts ranges from 0,3 kb to 2,8 kb (see FIG. 6 for the two longest clones). The sequence is not complete in 5'. In a secondround of library screening with a 400 bp DNA fragment corresponding to the most 5' fragment of the clone SPS 3, we obtain a SPS 61 clone extending further 5' without having the 5' end of the reading frame (FIG. 6). 6) Creation and screening of a secondcDNA library in order to clone the 5' sequence of cDNA coding for SPS.
A oligonucleotide complementary to the 5' sequence of clone SPS 61 is used as a primer for cDNA synthesis. After second strand reaction is completed, the cDNA is cloned into bacteriophage lambda GT11. The library includes about one millionclones. The SPS 90 and SP 77 have been obtained, by screening this library with SPS 61 (FIG. 6). 7) The assembled SPS reading frame.
DNA sequences which encode the SPS may be employed as a gene of interest in a DNA construct or as probes in accordance with this invention. When found in a host cell, the sequence may be expressed as a source of SPS. More preferred is the SPSsequence in a vegetal cell under the regulating control of transcriptional and translational initiation region functional in plants.
Vegetal cell means any plant cell being able to form undifferentiated tissues as callus or differentiated tissues as embryos, parts of plants, whole plants or seeds.
Plants means for example plant producing grain seeds for example such as cereals, such as wheat, barley, corn, or oat, leguminous such as soybean, oleaginous as turnesol, tuber as potato, plan with roots as beet or fruit as tomato. The sucrosephosphate synthase is a key enzyme, in sucrose regulation mechanism, but also in carbon partitioning regulation between starch and sucrose during photosynthesis (see Jack PREISS, TIBS January 1984, pages 24, or Mark STITT and Coll, BIOCHEMISTRY ofPLANTS, vol. 10, 1987, pages 3-27).
When found in a DNA construct for integration into a plant genome, the sequence may be found is a sense orientation or anti-sense orientation. By increasing the amount of SPS available to the photosynthetically active plant cell by theexpression of additional SPS, an increased flow of sucrose may be provided to growing tissues, for example, resulting in increased plant yields; by decreasing the amount of SPS available to the photosynthetically active plant cell, the rate of sucroserelease from the plant cell may be hindered, resulting in less new plant growth.
By "obtainable from corn" is meant that the sequence, whether the amino acid sequence or nucleic acide sequence, is related to a corn SPS, including a SPS recovered through use of nucleic acid probes, antibody preparations, sequence comparisonsor derivatives obtained through protein modeling or mutagenesis for example. Thus, one skilled in the art will readily recognize that antibody preparation, nucleic acid probes (DNA and RNA) and the like may be prepared and used to screen and recoverother plant sources for SPS. Typically, a homologously related nucleic acid sequence will show at least about 60% homology, and more preferably at least about 70% homology between the corn SPS and the given plant SPS of interest, excluding any deletionswhich may be present. Homology is found when there is an identity of base pairs an may be determined upon comparison of sequence information, nucleic acid or amino acid, or through hybridization reactions conducted under relatively stringent conditions,e.g., having a fairly low percentage of non-specific binding with corn SPS probes.
Probes can be considerably shorter than the entire sequence, but should be at least about 10, preferably at least about 15, more preferably at least 20 nucleotides in length. Longer oligonucleotides are also useful, up to the full length of thegene encoding the polypeptide of interest. Both DNA and RNA probes can be used.
A genomic library prepared from the plant source of interest may be probed with conserved sequences from corn SPS to identify homologously related sequences. Use of the entire corn SPS cDNA may be employed if shorter probe sequences are notidentified. Positive clones are then analyzed by restriction enzyme digestion and/or sequencing. In this general manner, one or more sequences may be identified providing both the coding region, as well as the transcriptional regulatory elements of theSPS gene from such plant source.
In use, probes are typically labeled in a detectable manner (for example with .sup.32 P-labelled or biotinylated nucleotides) and are incubated with single-stranded DNA or RNA from the plant source in which the gene is sought, although unlabeledoligonucleotides are also useful. Hybridization is detected by means of the label after single-stranded and double-stranded (hybridization) DNA or DNA/RNA have been separated, typically using nitrocellulose paper or nylon membranes. Hybridizationtechniques suitable for use with oligonucleotides are well known to those skilled in the art.
From cDNA sequences, one skilled in the art will be readily able to obtain the corresponding genomic DNA sequences related thereto to obtain the coding region of the SPS including intron sequences, transcription, translation initiation regionsand/or transcript termination regions of the respective SPS gene. The regulatory regions may be used with or without the SPS gene in various probes and/or constructs.
The complete SPS reading frame can be assembled using restriction enzyme fragments of SPS 90, SPS 61 and SPS 3, see FIG. 6.
When expressed in E. coli, the SPS cDNA produces a protein which is recognized by anti SPS antisera and has the same electrophoretic mobility as SPS extracted from corn leaves. We show that this E. coli SPS is as active as plant SPS, i.e. forcomplete enzymatic activity in E. coli no other plant factor is needed but the SPS cDNA.
Plants obtained by the method of transformation and containing fusions of SPS cDNA to tissue specific promoters in order to modify or alter the composition of certain plant organs is also included.
A DNA construct of this invention may include transcriptional and translational initiation regulatory regions homologous or heterologous to the plant host. Of particular interest are transcriptional initiation regions from genes which arepresent in the plant host species, for example, the tobacco ribulose biphosphate carboxylase small subunit (ssu) transcriptional initiation region; the cauliflower mosaic virus (CaMV) 35S transcriptional initiation region, including a "double" 35S CaMVpromoter, and those associated with T-DNA, such as the opine synthase transcriptional initiation region, e.g., octopine, mannopine, agropine, and the like.
Any one of number of regulatory sequences may be preferred in a particular situation, depending upon whether constitutive or tissue and or timing induced transcription is desired, the particular efficiency of the promoter in conjunction with theheterologous SPS, the ability to join a strong promoter with a control region from a different promoter which allows for inducible transcription, ease of construction and the like. For example, tissue specific promoters may be employed to selectivelymodify or alter the composition of certain plant organs. These regulatory regions find ample precedence in the literature.
The termination region may be derived from the 3'-region of the gene from which the initiation region was obtained, from the SPS gene, or from a different gene. Preferably the termination region will be derived from a plant gene, particularly,the tobacco ribulose biphosphate carboxylase small subunit termination region; a gene associated with the Ti-plasmid such as the octopine synthase termination region or the tml termination region.
In developing the expression cassette, the various fragments comprising the regulatory regions and open reading frame may be subjected to different processing conditions, such as ligation, restriction, resection, in vitro mutagenesis, primerrepair, use of linkers and adapters, and the like. Thus, nucleotide transitions, transversions, insertions, deletions, or the like, may be performed on the DNA which is employed in the regulatory regions and/or open reading frame.
During the construction of the expression cassette, the various fragments of the DNA will usually be cloned in an appropriate cloning vector, which allows for amplification of the DNA, modification of the DNA or manipulation by Joining orremoving of the sequences, linkers, or the like. Normally, the vectors will be capable of replication in at least a relatively high copy number in E. coli. A number of vectors are readily available for cloning, including such vectors as pBR322, pUCseries, M13 series, etc. The cloning vector will have one or more markers which provide for selection of transformants. The markers will normally provide for resistance to cytotoxic agents such as antibiotics, heavy metals, toxins, or the like. Byappropriate restriction of the vector and cassette, and as appropriate, modification of the ends, by chewing back or filling in overhangs, to provide for blunt ends, by addition of linkers, by tailing, complementary ends can be provided for ligation andjoining of the vector to the expression cassette or component thereof.
After each manipulation of the DNA in the development of the cassette, the plasmid will be cloned and isolated and, as required, the particular cassette component analyzed as to its sequence to ensure that the proper sequence has been obtained. Depending upon the nature of the manipulation, the desired sequence may be excised from the plasmid and introduced into a different vector or the plasmid may be restricted and the expression cassette component manipulated, as appropriate.
The manner of tranformation of E. coli with the various DNA constructs (plasmids or viruses) for cloning is not critical to this invention. Conjugation, transduction, transfection or transformation, for example, calcium phosphate mediatedtransformation, may be employed.
In addition to the expression cassette, depending upon the manner of introduction of the expression cassette into the plant cell, other DNA sequences may be required. For example when using the Ti- or Ri-plasmid for transformation of plantcells, as described below, at least the right border and frequently both the right and left borders of the T-DNA of the Ti- or Ri-plasmids will be Joined as flanking regions to the expression cassette. The use of T-DNA for transformation of plant cellshas received extensive study and is amply described in Genetic Engineering, Principles and Methods (1984) Vol 6 (Eds. Setlow and Hollaender) pp. 253-278 (Plenum, N.Y.); A. Hoekema, in: The Binary Plant Vector System (1985) Offsetdrukkerij Kanters, B.V. Alblasserdam.
Alternatively, to enhance integration into the plant genome, terminal repeats of transposons may be used as borders in conjunction with a transposase. In this situation, expression of the transposase should be inducible, so that once theexpression cassette is integrated into the genome, it should be relatively stably integrated and avoid hopping.
The expression cassette will normally be joined to a marker for selection in plant cells. Conveniently, the marker may be resistance to a biocide, particularly an antibiotic, such as Kanamycin, G418, Bleomycin, Hygromycin, Chloramphenicol, orthe like. The particular marker employed will be one which will allow for selection of transformed plant cells as compared to plant cells lacking the DNA which has been introduced.
A variety of techniques are available for the introduction of DNA into a plant cell host. These techniques include transformation with Ti-DNA employing A. tumefaciens or A. rhizogenes as the transforming agent, protoplast fusion, injection,electroporation, DNA particle bombardment, and the like. For transformation with agrobacterium, plasmids can be prepared in E. coli which plasmids contain DNA homologous with the Ti-plasmid, particularly T-DNA. The plasmid may be capable of replicationin Agrobacterium, by inclusion of a broad spectrum prokaryotic replication system, for example RK290, if it is desired to retain the expression cassette on a independent plasmid rather than having it integrated into the Ti-plasmid. By means of a helperplasmid, the expression cassette may be transferred to the A. tumefaciens and the resulting transformed organism used for transforming plant cells.
Conveniently, explants may be cultivated with the A. tumefaciens or A. rhizogenes to allow for transfer of the expression cassette to the plant cells, the plant cells dispersed in an appropriate selection medium. The Agrobacterium host willcontain a plasmid having the virgenes necessary for transfer.
After transformation, the cell tissue (for example protoplasts, explants or cotyledons) is transferred to a regeneration medium, such as Murashige-Skoog (MS) medium for plant tissue and cell culture, for formation of a callus. Cells which havebeen transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al., Plant Cell Reports (1986) 5:81-84. The transformed plants may then be analyzed to determine whether the desired gene product is stillbeing produced in all or a portion of the plant cells. After expression of the desired product has been demonstrated in the plant, the plant can be grown, and either pollinated with the same transformed strain or different strains and the resultinghybrid having the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that the subject phenotypic characteristic is stably maintained and inherited. 1 - PURIFICATION OF SUCROSE PHOSPHATE SYNTHASE OF CORN
1.1 - Method of determination of enzymatic activity (SPS)
During purification SPS activity is followed in 2 ways: a) either by means of a colorimetric test (P. S. Kerr et al., Planta., 1987, 170:515-519) called resorcinol test described below. Sucrose Phosphate Synthase or UDP glucose - D Fructose -Phosphate Glucosyltransferase (BC 2.4.1.14) catalyzes the reaction: UDPG+Fructose 6-P<=>Sucrose 6-P+UDP UDPG: Uridine Di-Phospho Glucose Fructose 6-P or F6P: Fructose 6-Phosphate Sucrose 6-P: Sucrose 6-Phosphate
The sucrose 6-P formed reacts with the Resorcinol to give a red-colored compound quantifiable by spectro-photometry at 520 nm (nanometer) (Optical Density (O.D.)=520 nm). In practice, to 45 .mu.l (microliter) of enzymatic preparation 25 .mu.l ofa buffered solution containing the two substrates is added (UDPG 70 mM, F6P 28 mM, MgCl.sub.2 15 mM, HEPES 25 mM pH 7,5). After incubation at 37.degree. C., reaction is stopped by adding 70 .mu.l of NaOH in Solution and heating at 95.degree. C. during10 mm. After cooling, 0,25 ml of a solution 0,1% resorcinol in ethanol 95% is added, then 0,75 ml of HCl 30% is added. The OD 520 mM is read after incubation 8 mn at 80 mn, and cooling. b) or by means of a coupled enzymatic system (S. Harbron et al.,Anal. Biochem. 1980, 107: 56-59) being composed in the following way:
UDPG + F6P {character pullout} Sucrose 6 P + UDP SPS UDP + ATP {character pullout} ADP + UTP Nucleoside Diphosphokinase NP.sub.2 K ADP + PEP {character pullout} Pyruvate + ATP Pyruvate kinase PK Pyruvate + NADH {character pullout} NAD +lactate Lactate dehydrogenase LDH
The disappearance of the NADH absorption at 340 nm is monitored 1 mole of NAD formed or 1 mole of NADH consumed corresponds to 1 mole of sucrose 6 P formed.
In practice, in a quartz spectrophotometric tun thermostated at 37.degree. C., the following solution are added. - 540 .mu.l of HEPES buffered 50 mM, MgCl.sub.2 10 mM KCl 20 mM pH=7.5, - 250 .mu.l of a mixture of substrates PEP (1,6 mM NaDH 0,6mM, ATP 4 mM UDPG 112 mM), - 60 .mu.l of an enzyme mixture (LDH 166,7 U/ml PK 333,3 U/ml, NPzK 66,7 U/ml), - 100 .mu.l of F6P 112 mM.
After homogenization, 50 .mu.l of the preparation containing SPS is added, the diminution of optical density at 340 nm is added with a spectrophotometer (UVIKON 860, KONTRON instruments). The measure is done with the kinetic of the machine. 1.2- Purification of the SPS (preparation of the immunogen) 1.2.1 - Extraction
The starting material for the purification are mature leaves of young corn plants (Zea mays L. cv Pioneer 3184), which have been harvested in late morning, cut up, deveined, frozen in liquid nitrogen and stored at -70.degree. C.
250 g of leaves are suspended in 1 liter of 50 mM HEPES 10 mg MgCl.sub.2 1 mM EDTA 5 mM DTT, pH=7.5 buffer (extraction buffer) which has observed to it 11 g of Polyvinyl-pyrrolidone nitrogen is bubbled through and the suspension is cooled to0.degree. C.
The leaves are ground, until a homogeneous liquid is obtained. This ground product is filtered, and then centrifuged at 14,000 g for 20 minutes at 4.degree. C.
While the bubbling through of nitrogen is maintained, a solution of 50% Poly Ethylene Glycol (PEG 8000 "Breox" at 50% w/v of extraction buffer) is added to the supernatant until a final concentration of PEG of 6% is reached. Then the suspensionis cooled at 0.degree. C. After centrifugating at 14,000 g for 20 minutes the supernatant has added to it 50% PEG until a final concentration of PEG of 12% is reached. After a repeated centrifugation, the supernatant is discarded and the residue issolubilized with 60 ml of 50 mM HEPES, 10 mM MgCl.sub.2, 1 mM EDTA, 5 mM DTT, 10% Ethylene Glycol (EG), 0.08M KCl, pH 7.5 buffer (recovery buffer). This solution is clarified by centrifuging at 40,000 g for 10 minutes. The supernatant constitutes thefinal extract. 1.2.2. - Low pressure anion-exchange chromatography: fast-flow DEAE Sepharose exchanger
The final extract is chromatographed on a column 25 mm.times.162 mm of 80 ml of Fast-Flow DEAE Sepharose PHARMACIA equilibrated with recovery buffer. After washing the column with the same buffer, the proteins adsorbed on the support are elutedby means of a linear gradient with increasing ionic strength between 0.08M KCl and 0.35M KCl in the 50 mM HEPEs, 10 mM MgCl.sub.2, 1 mM EDTA, 5 mM DTT, 10% EG, pH 7.5 buffer (buffer A). The flow rate applied during this experiment is 180 ml/h andchromatography is executed at 4.degree. C.
The SPS activity is eluted at about 0.17M KCl. 1.2.3 - Chromtography on heparin Sepharose
The fractions containing the SPS activity are collected and diluted to one fifth in buffer A, then added to 12 ml of heparin Sepharose previously equilibrated with buffer A. After one hour of incubation with genetic agitation at 4.degree. C.,the gel is washed with about 10 volume of buffer A+0.05M KCl, then repacked in a chromatography column.
The proteins adsorbed are eluted in an isocratic way by means of a 10 mM CAPS, 10 mM MgCl.sub.2, 1 mM EDTA, 5 mM DTT, 10% EG, 0.01% Tween 80, 1 mg/ml heparin, 1% Fructose, 0.25M KCl, pH 10 buffer, delivered at 60 ml/h.
Chromatography is executed at 4.degree. C.
The fractions containing the SPS activity are collected (heparin fraction) and preserved on ice until the following purification stage. The enzyme at this stage is stable for a least one weak.
The following purification steps are carried out using a system of High Performance Liquid Chromatography (HPLC); the purification is followed by means of a detector fitted with a filter enabling absorbency in the ultra-violet at 280 nm (A280) tobe measured. The buffers and the fractions recovered are kept at low temperature. 1.2.4 - High performance anion-exchange chromatography: Mono Q
The heparin fraction is diluted by adding one third volume of 20 mM Triethanolamine, 10 mM MgCl.sub.2, 1 mM EDTA, 10 mM DTT, 3% EG, 0.3% Tween 80, pH 7.5 buffer (buffer A) and loaded on an FPLC Mono Q HR10/10 column, (10.times.100 mm PHARMACIA)previously equilibrated with the same buffer which has added to it NaCl (final concentration 0.18M). After the A280 has returned to 0, the proteins absorbed on the chromatography support are eluted by means of a salt-complex gradient comprised asfollows: buffer A: cf above buffer B: buffer A+NaCl 1M
time (minutes) % B 0 18 0.1 24 15 24 19 26 23 26 33 31 38 31 41 100 43 18
The flow rate applied to the column is 180 ml/h.
The SPS activity is eluted between 0.26 and 0.31M NaCl.
The active fractions are collected together ("Mono Q fraction"). 1.2.5 - HPLC on Hydroxyapatite
The Mono Q fraction is loaded on an HPLC column of hydroxyapatite 4 mm.times.75 mm neutralized with 20 mM KH.sub.2 PO.sub.4 /K.sub.2 HPO.sub.4, 3% EG, 0.3% Tween 80, 5 mM DTT, pH 7.5 buffer. After the A280 has returned to 0, the proteinsadsorbed are eluted by means of the following phosphate gradient:
buffer A: cf above
buffer B: idem buffer A but 500 mM Phosphate of K
time (minutes) % B 0 2 5 11 9 13 14 13 29 40 31 100 32 100 35 2
The flow rate applied is 60 ml/h. At this stage, the phosphate will partially inhibit SPS activity and therefore it is difficult to calculate a specific activity and also a purification factor (cf table 1) at this stage.
The SPS activity is eluted under these conditions with about 60 mM phosphate.
The active fractions are collected together and constitute the HAC fraction. 1.2.6 - HPLC on DEAE 5PW
The HAC fraction is loaded on an anion-exchange HPLC column of Di Ethyl Amino Ethyl type (DEAE-SPW) previously neutralized with a buffer of 20 mM Triethanolamine, 10 mM MgCl.sub.2, 1 mM EDTA, 3% EG, 2.5 mM DTT, 2% betaine, pH 7.5 buffer (bufferA)+0.15M NaCl.
After the A280 has returned to 0, the proteins adsorbed are eluted by means of the following NaCl gradient: buffer A: cf above buffer B: idem buffer A with 1M NaCl
time (minutes) % B 0 15 0.1 20 5 20 22 35 27 35 30 100 31 15
The flow rate used is 60 ml/h.
The SPS activity is eluted with about 0.3M NaCl. 1.2.7 - Preparation of the final preparation: concentration
The final preparation is concentrated by HPLC chromatography on Mono Q HR5/5 exchanger (5.times.50 mm, Pharmacia) and rapid elution.
The DEAE 5PW fraction (or the G200 fraction) is diluted to two thirds with buffer A (idem 6) and loaded on the column previously neutralized with buffer A+0.18M NaCl. The following gradient is then applied on the column: buffers A and B: idem 6
time (minutes) % B 0 18 10 40 12 100 13 18
The flow rate used is 60 ml/h.
The SPS activity is eluted with about 0.3M NaCl.
The final preparation is stored at -20.degree. C. until used. Table 1 summarizes the results obtained at the various purification stages in terms of quantities of proteins recovered and of SPS activity.
TABLE 1 Concentration of Volume sA** Y* proteins (mg/ml) (ml) (U) pF** (%) Ground 1 1000 0.05 0 100 product Final extract 4 << 8 60 0.30 6 144 DEAE FF fraction 0.4 << 0.8 70 3 60 168 Heparin fraction 0.2 << 0.4 25 9 18090 Mono Q fraction (0.02) 30 -- -- -- HAC fraction (0.03) 8 -- -- -- Final preparation 0.05 2 25 500 5 Key sA = Specific enzymatic activity: 1 U corresponds to 1 .mu.m of sucrose formed per minute per mg of protein at 37.degree. C. pF =Purification factor Y = Yield () = approximate value -- = not determined
Observations: ** the measurement of the quantity of proteins is carried out using the Bradford method. As Tween interferes enormously with this method, it is not possible to determine the proteins and then to calculate an sA at the level of thestages containing one. Furthermore, as phosphate is an inhibitor of SPS activity, the determination during the HAC stage gives an underestimated result.
* the increasing yield during the initial stages can be explained by the elimination, during purification, of certain inhibitor of SPS activity.
An SDS-PAGE profile at various stages of the purification process and the quality of the final preparation is given in FIG. 1. The 120, 95 and 35 kd proteins are correlated to the SPS activity.
The 35 and 95 kd proteins are very likely breakdown products of the 120 kd protein as it can be shown by the nucleotidic sequence coding for the SPS protein.
Furthermore, the antibodies directed against the 35 and 95 kd proteins also recognize the protein 120 kd in immunodetection after membrane transfer, which demonstrates an antigenic identity between these three proteins (see below). It must bepointed out, however, that the addition of protease inhibitors in the buffers during purification has not enabled us to obtain a single 120 kd protein.
Gel permeation chromatographies were carried out in order to find the apparent molecular weight of the native SPS protein. Briefly, the HAC fraction is concentrated by HPLC chromatography on Mono Q HR 5/5 inchanger (see 1-2-7). The activefractions are collected together (about 2 ml) and loaded on an G 200 column previously washed with a buffer containing 20 mM triethanolamin, 10 mM MgCl.sub.2, 1 mM EDTA, 3% E.G., 2,5 mM DTT, 2% betain, 0,3M NaCl pH 7,5. The SPS activity is eluted amajor protein peak corresponding to an apparent mass of 270-280 kda which is in agreement with the results obtained by S. HARBRON an al. (Arch. Biochem. Biophys., 1981, 212: 237-246) with the spinach SPS. It can be noted that the chromatography on aTS lambda 60000 permeation column lead to the elution of the SPS activity at a retention time corresponding to an apparent mass of 440 kda which is near from the value obtained by DC DOEHLERT and S. C. HUBER (Plant Physiol., 1983, 73:989-994) with thespinach SPS, using a AcA34 permeation column.
The SPS protein seems therefore to be a di or tetrameric protein having as the basic sub-unit a 120 kda protein (homo-dimeric or homo-tetrameric).
Key for FIG. 1 SDS-PAGE profile of sucrose phosphate synthase of corn: 8.5% acrylamide gel, reducing conditions and staining with silver nitrate M: Standard of molecular weight B-Galactosidase (116 kd), bovine Albumin (68 kd), Egg Albumin (45kd), carbonic Anhydrase (29 kd). H: Heparin fraction, 30 micrograms of proteins per well. FP: Final Preparation, 7.5 micrograms of proteins per well. FE: Final Extract, 7.5 micrograms of proteins per well. D: Fast-Flow DEAE fraction, 7.5 microgramsof proteins per well.
The bands of proteins visible at about 120 kd (1), 95 kd (2) and 35 kd (3) are correlated, during the chromatography stages, with the appearance of SPS activity in the respective fractions. 2 - PROCESS FOR THE PREPARATION OF MONOCLONALANTIBODIES DIRECTED AGAINST SUCROSE PHOSPHATE SYNTHASE 2.1 - Immunisations
BALB/C mice are immunized by subcutaneous injection (pads and paws) according to the following methodology: Day 0 injection of about 5 micrograms of proteins (or about 0.3 U SPS per mouse): Mono Q Pool emulsified volume for volume with Freund'sComplete Adjuvant (FCA).
Day 14 injection of about 5 micrograms of proteins (or about 0.3 U SPS per mouse): Mono Q pool emulisified volume for volume with Freund's Incomplete Adjuvant (FIA). Day 27 Idem D14 Day 0+60 injection of about 20 micrograms of proteins: finalpool in FIA Day 0+90 injection of about 12 micrograms of proteins: final pool in FIA Day 0+135 injection by intravenous route (IV) in the tail of about 20 micrograms of proteins: final pool. Fusion is achieved 3 days after the IV immunisation.
The sera are removed at D34, D61, D98 and D159 in order to measure the immunitary response (cf screening). 2.1.1 - Screening method
As the SPS used for the immunisations is not perfectly homogeneous, it is necessary to establish a screening test specific to this enzyme.
Two methods for the detection of the antibodies are used: - detection method of antibodies inhibiting the SPS activity - detection method of antibodies directed against the SPS (inhibiting or not). a) Detection method of antibodies inhibitingthe SPS activity This method of screening allows the detection of antibodies which interfere with the active site of the SPS or on a site close to the latter, and therefore prevent the access of substrates. In practice, 70 .mu.l of serum or ofsupernatant of hybridoma culture diluted in a suitable way is mixed with 70 .mu.l of SPS preparation (Heparin fraction). After one hour of incubation at ambient temperature, the residual SPS activity is determined by coupled enzymatic determination (Cf1--1). The results are expressed as a percentage of inhibition as compared to the same SPS preparation treated in the same way but without antibodies. b) Detection method of antibodies directed against SPS (inhibiting or not)
This method is based on the precipitation of the antibody-SPS complex by goat anti-mouse IgG coupled to sepharose beads (GAM sepharose). In practice, 60 .mu.l of serum or supernatant of hybridoma culture diluted in any suitable manner is addedto 60 .mu.l of SPS preparation (Heparin fraction). After 2 hours of incubation at ambient temperature, the mixture is added to 50 .mu.l of 25% GAM-Sepharose previously washed three times with a buffer of 50 mM HEPES, 10 mM MgCl.sub.2, 1 mM EDTA, 10% EG,5 mM DTT, pH 7.5. The mixture is incubated over night at 4.degree. C. under strong agitation. After centrifuging for 5 minutes at 3000 rpm the residual SPS activity in the supernatant is determined by coupled enzymatic determination (Cf 1.1). Theresults are expressed as a percentage of precipitation (% prec.) compared to the same SPS preparation treated in the same way without antibodies. 2.1.2 - Results
10 mice were immunized according to the protocol described previously. The following table gives the results of the precipitation determinations carried out with the heteroantisera of the 10 mice on D159. The sera are diluted to onetwo-hundredth.
MOUSE 1 2 3 4 5 6 7 8 9 10 % PREC. 45 22 32 64 36 30 22 16 39 37
Additional dilutions of the serum of mouse 4 give the following results:
DILUTION % PRECIPITATION 1/200 67 1/400 48 1/600 29 1/1000 20
The spleens of mice i and 4 are used for the fusion. 2.2 - Cellular fusion
The splenocytes of the mice are fused with myeloma cells of SP2/0-Ag14 mice according to a ratio of 2/1 in the presence of 45% polyethylene glycol 1500. The selection of the hybridomas is effected by adding hypoxanthine and azaserine to theculture medium 24 and 48 hours after fusion.
The hybridomas are cloned and sub-cloned by the method of limited dilution. 2.2.1 - Results of the screening of hybrids and clones.
HYBRIDS MOUSE 4 (SPA fusion) MOUSE 1 (SPB fusion) 2 positive hybrids 6 positive hybrids out of 45 out of 52 SPA2: 38% prec. SPB3: 17% prec. SPA19: 7% prec. SPB5: 67% prec. SPB8: 53% prec. SPB13: 68% prec. SPB25: 13% prec. SPB34: 17%prec. CLONES SPA FUSION SPB FUSION 2 clones retained 7 clones retained out of 36 out of 46 SPA2-2: 85% prec. SPB3-2: 19% prec. SPA19-7: 8% prec. SPB5-1: 76% prec. SPB5-2: 71% prec. SPB5-3: 45% prec. SPB5-4: 24% prec. SPB13-1: 79% prec. SPB13-2: 53% prec. SUB-CLONES SPA FUSION SPB FUSION 3 sub-clones retained 5 sub-clones retained out of 48 out of 72 SPA2-2-3: 60% prec. SPB3-2-19: 21% prec. SPA2-2-22: 33% prec. SPB5-2-10: 86% prec. SPA2-2-25: 92% prec. SPB5-4-2: 46% prec. SPB13-1-7: 87% prec. SPB13-2-2: 93% prec. 2.2.2 - Production of anti-SPS monoclonal antibodies
The hydridomas are injected by intra-peritoneal route into female BALB/C mice previously treated with pristane. The monoclonal antibodies are partially purified from ascital liquids thus produced by precipitation with 18% sodium sulphate. Theproteins precipitated are dissolved then dialyzed against PBS (F18). 2.2.3 - Characterization of anti-SPS monoclonal antibodies a) Typing
The typing is done using an ELISA test. Anti-IgG rabbit and anti-IgM mouse antibodies (ZYMED) are fixed at the bottom of the wells of a 96-well plate. After one night at ambient temperature the unoccupied sites are saturated with a solution of3% bovine serum albumin in PBS. After one hour of incubation at 37.degree. C. and several washes, the various F18's are deposited in the wells. After incubation and several washes, goat or rabbit antibodies, anti-class and anti-sub class mouseimmunoglobulins linked with peroxidase, are added. After one hour at 37.degree. C., the antibodies are revealed using an H.sub.2 O.sub.2 /ABTS system.
All the anti-SPS monoclonal antibodies were found to be of Ig G.sub.1 type. b) Inhibition of SPS activity
The determination of the capacity of the antibodies to inhibit the SPS activity is carried out by the technique mentioned previously (Cf 2.1.1 a) using F18's.
Concentration of antibodies Antibody (micrograms/ml) % Inhibition SPA2-2-3 50 0 SPA2-2-22 50 0 SPA2-2-25 50 0 SPB3-2-19 50 0 SPB5-2-10 50 0 SPB5-4-2 50 0 SPB13-1-7 50 50 25 55 5 25 2.5 10 1 2.1 SFB13-2-2 50 60.1 25 59.1 5 33.8 2.5 14.2 1 8.7 c) Immuno-precipitation of the SPS activity The determination of the capacity of the antibodies to immuno-precipitate the SPS activity is carried out by the technique mentioned previously (Cf 2.1.1 b) using F18's.
Concentration of antibodies Antibody (micrograms/ml) % Precipitation SPA2-2-3 50 95 25 92 5 80 2.5 40 1 20 SPA2-2-22 50 95.7 25 95 10 51 5 48.2 2.5 25 1 10 SPA2-2-25 50 91.3 25 95.3 5 90.4 2.5 22.8 1 12.5 SPB3-2-19 50 95 2595 5 27.8 2.5 17.8 1 9.3 SPB5-2-10 50 95 25 95 5 81.1 2.5 41.4 1 22.6 SPB5-4-2 50 95 25 95 5 86.1 2.5 57.2 1 26.1 SPB13-1-7 50 95 25 95 10 65.4 5 48.1 2.5 15 1 10 SPB13-2-2 50 95 25 95 5 71.8 2.5 43.5 3 - USE OF THE MONOCLONALANTIBODIES FOR THE CHARACTERIZATION AND PURIFICATION OF SUCROSE PBOSPHATE SYNTHASE 3.1 - Characterization of Corn Sucrose phosphate
This characterization is carried out with SPB3-2-19 and SPB13-2-2 antibodies by the technique of immunodetection after transfer of the proteins from an electrophoresis gel under denaturing conditions (SDS-PAGE) on nitrocellulose membrane(western).
After electrophoretic separation in a 12.5% acrylamide gel (Nature 277 (1970) 680-685), the proteins are transferred onto a 0.22 .mu.m nitrocellulose membrane (Schleicher and Schuell). The buffer is a standard electrophoresis buffer (3.03 g/l.TRIS base, 14.4 g/l, Glycine, 0.1% SDS, pH 8.3, 20% methanol).
After transfer, the membrane is put in a blocking bath (0.5% Casein in PBS). After one hour at 37.degree. C. under gentle agitation, the membrane is washed 3 to 4 times in a washing buffer (0.1% Casein, 0.5% Tween 20, in PBS) then incubatedwith a solution of 10 micrograms/ml of the monoclonal antibody to be tested. A part of the membrane is incubated in parallel with a non-immune anti-body (negative control). After one hour of incubation at ambient temperature followed by 9 or 10 washes,the membrane is incubated in the presence of an anti-mouse antibody antibody labelled with Iodine 125 diluted in a washing buffer (50,000 cpm per cm.sup.2 of membrane). After one hour of incubation at ambient temperature followed by 9 or 10 washes, themembrane is dried, then autoradiographed (X-OMAT AR KODAK film and Cronex XTRA Life DUPONT amplifying screen). An autoradiography is shown in FIG. 2. A strong signal is observed at the protein bands 120 kd, 95 kd and 35 kd which correlates with theprevious results (see first part). Key to FIG. 2 A: membrane incubated in the presence of the SPB3-2-19 antibody B: membrane incubated in the presence of an antibody not directed against SPS (negative control anti-neomycin monoclonal antibody) C:membrane incubated in the presence of the SPB13-2-2 antibody M: standards of molecular weight radio-marked by 1251 (NEX-188 NEN) B-Galactosidase (116 kd), bovine albumin (68 kd), carbonic Anhydrase (29 kd), trypsic Inhibitor (20.1 kd), Alpha-Lactalbumin(14.4 kd), 150,000 cpm per lane PA: proteins obtained after immunoaffinity chromatography (see below) with the SPB13-2-2 monoclonal antibody, about 40 micrograms of proteins per lane. H: Heparin fraction, about 40 micrograms of proteins per lane. 3.2 -Purification of Sucrose Phosphate Synthase by immunoaffinity Chromatography
A methodology for the purification of corn Sucrose Phosphate Synthase on an immunoaffinity support has been perfected in order to increase the quantity of protein recovered while reducing the number of purification stages and to obtain quantitiessufficient for protein sequencing. 3.2.1 - Preparation of the immuno-adsorbent
The F18 (see 2.2.2) corresponding to the SPB13-1-7 antibody or to the SPB-13-2-2 antibody were mixed with activated CH-Sepharose, (1 mg of antibody per ml of gel). After incubation for 2 hours at ambient temperature, the sites not occupied bythe antibodies are saturated with 1M ethanolamine, pH 9. The support is then washed alternately with 0.1M acetate 0.5M NaCl pH 4 buffer and 0.1M TRIS 0.5M NaCl pH 8 buffer. The immunoaffinity support thus prepared is preserved at 4.degree. C. in a 50mM HEPES, 10 mM MgCl.sub.2, 1 mM EDTA, 1 mM PMSF, 0.01% sodium nitride (azide), pH 7.5 buffer. 3.2.2 - Immunoaffinity Chromatography
50% PEG is added to the Heparin fraction of SPS (see 1.2.3.) is added 50% PEG (see 1.2.1) to a final concentration of PEG of 20%. After incubation for 30 minutes at 4.degree. C. with gentle agitation, the mixture is centrifuged at 1600 g for 30minutes. The protein deposit is taken up in half of the initial volume with the 50 mM HEPES, 10 mM MgCl.sub.2, 1 mM EDTA, 10% ethylene glycol pH 7.5 buffer. This stage allows the previous buffer, which is incompatible with the immunoaffinitychromatography, to be eliminated, and the proteins to be concentrated. The yield of SPS activity is from 80 to 90%.
The solution obtained is applied with a flow rate of 0.1 ml/min over 1 ml of immunoaffinity support packed in a column and on which has been fixed an antibody not directed against the SPS (activated CNBr-Sepharose, on which an anti-neomycinantibody is fixed). This first stage allows the elimination of certain contaminants which are fixed non-specifically on the chromatography support. The effluent of the non-specific column is in its turn applied to the anti-SPS immunoaffinity support (2ml in an 11.times.20 mm column) with a flow rate of 0.1 ml/min. These two stages are carried out at laboratory temperature. The column is washed with 10 ml of load buffer and then with a washing buffer (load buffer with the addition of 0.25M NaCl and0.3% Tween 20) until absorbency in ultra-violet at 280 nm is close to base level. The proteins adsorbed on the support are eluted with a solution of 50 mM triethyl-amine, pH 11. This slution is carried out at 4.degree. C. and the immunoaffinity columnis reversed to obtain an optimum yield. The SDS-PAGE profile of the final preparation obtained corresponds to that obtained using the standard protocol (see 1). It must be noted that the slution method of the proteins adsorbed on the immunoaffinitysupport irreversibly destroys the SPS activity but the recovery yield of the eluted SPS proteins is optimal compared to tests carried out in native slution conditions. The eluate of the immunoaffinity column is desalted with a Sephadex G25 column,against a 0.14% Glycerol, 0.07% 2-mercapto-ethanol, 0.04% SDS, 0.9 mM TRIS pH 6.8 buffer (electrophoresis buffer in reducing conditions diluted 70 times). After desalificatiion, the protein preparation is concentrated 70 times with a concentrator undervacuum and the SPS proteins are purified by SDS-PAGE (see below). 4. Partial Sequencing of SPS Polypeptides
Samples of a purified protein preparation obtained as described in Example 3.2.2. were subjected to preparative SDS-PAGE. After electrophoresis, the protein bands were visualized with KCl treatment as described by Bergman and Joernvall (Eur. Jour. Biochem. (1978) 169:9-12) and the bands observed at 90 kd and 30 kd were excised. The proteins from these gel fragments were electroeluted using an Electrophoretic Concentrator according to manufacturer's instructions (ISCO: Lincoln, Neb.) in 4mM sodium acetate, pHS. After electroelution, protein yields were quantitated by comparison to a bovine serum albumin (BSA) standard on a Coomassie Blue-stained gel. Approximately 30 .mu.g of the 30 kd protein and 75 .mu.g of the 90 kd protein wereobtained.
The proteins were concentrated by acetone precipitation, and resuspended in 50 mM ammonium carbonate buffer, pHS. Tryptic digestion and HPLC purification were performed as described by Sturn and Chrispeels (Jour. Biol. Chem. (1987)262:13392-13403). Briefly, digestion was performed by addition of trypsin (5% of sPs protein), and incubation for two hours at 37.degree. C. The digestion was then repeated. The proteins were concentrated by lyophilization and resuspended in 50mMsodium phosphate buffer, pH2.2. This mixture was subjected to reverse phase HPLC separation by application to a C18 column in phosphate buffer. Elution was performed using an increasing gradient of acetonitrile. Eluted material from the phosphatebuffer/acetonitrile gradient was monitored at 214 nm. The fractions corresponding to peaks of absorbance at 214 nm were collected, lyophilized, resuspended in 0.1% trifluoroacetic acid, reapplied to the C18 column (equilibrated with 0.1% trifluoroaceticacid), and eluted using an acetonitrile gradient. Eluted material from the trifluoroacetic acid/acetonitrile gradient was monitored at 214 nm. The fractions corresponding to peaks of absorbance at 214 nm were collected, lyophilized, and subjected tostandard Edman degradation protein sequencing on an automated protein sequencer (Applied Biosystems; Foster City, Calif.). Sequences of 5 peptides were obtained. FIG. 3 (SEQ ID NOS: 1-5). 5. Isolation and Assembly of a Full-Length cDNA for SPS 5.1RNA Isolation from Corn Leaf
Total RNA was isolated from corn leaves (see 1.2.1.) according to the method of Turpen and Griffith (Biotechniques (1986) 4:11-15). Briefly, 250 gm of material was homogenized in 4M guanidine thiocyanate and 2% sarcosyl. The mixture was thencentrifuged and the cleared supernatant was layered upon a 5.7M CsCl cushion and centrifuged for 5.5 hours at 50,000 RPM. The RNA pellet was dissolved in water, extracted with phenol and chloroform, and precipitated with ethanol. The resulting pelletwas resuspended in water. The final yield of the RNA isolation was quantitated by UV spectrophometry. 5.2 Poly(A) RNA Isolation
A saturated suspension of cellulose powder/water was added to the RNA/water mixture, at 10% of the total volume, to remove residual polysaccharides. After centrifugation, the supernatant, containing the RNA, was applied to an oligo(dT)-cellulose column as described by Maniatis et al. (Molecular Cloning: A Laboratory Manual, (1982) Cold Spring Harbor, N.Y.). The fraction containing the poly(A)+RNA was then reapplied to the column. The eluted fraction containing the poly(A)+RNAwas extracted with phenol, and the RNA was precipitated with ethanol. Analysis by gel electrophoresis showed complete absence or ribosomal RNA. 5.3. Construction of Total Corn Leaf Library
cDNA synthesis was performed according to manufacturer's instructions (RiboClone cDNA Synthesis System by Promega, Madison, Wis.), using five .mu.g of poly(A)+RNA as template, except that M-MLV reverse transcriptase (BRL; Bethesda, Md.) wassubstituted for AMV reverse transcriptase. EcoRI linkers were added to the blunt-ended cDNA, and the resulting fragments were cloned into an expression vector (LambdaZAP, Stratagene; La Jolla, Calif.) according to manufacturer's instructions. Theresulting library contained approximately 1.5.times.10.sup.6 transformants. 5.4 PCR Generation of a Partial SPS cDNA Probe
Using the sequence information from the peptides of Example 4 (SEQ ID NOS: 7-8) and the polymerase chain reaction (PCR), a 1200 bp SPS cDNA fragment was generated. Total corn leaf cDNA (5.3) was used as a template, and degenerateoligonucleotides (SEQ ID NOS: 9-12), designed from two peptide sequences of the 30 kd and 90 kd SPS polypeptides, were used as primers. These primer sets were designated as CD3 (SEQ ID NOS: 9-10) and CD4. (SEQ ID NOS: 11-12) FIG. 4 PCR was carried out,according to manufacturer's instructions (GeneAmp DNA Amplification Reagent Kit and DNA Thermal Cycler of Perkin Elmer Cetus; Norwalk, Conn.) except that the reaction was carried out for 30 cycles, and the annealing steps were programmed to be 50.degree. C. for 1 minute. The PCR reactions were analyzed by agarose gel electrophoresis. Use of the correct set of primers, which was CD3, resulted in a 1200 bp band being generated by the PCR reaction. PCR using the other set of primers, CD4, gave nospecific signals. FIG. 5A and FIG. 5B. Southern analysis confirmed that the PCR band was not an artifact, as shown in FIG. 5A and FIG. 5B. The probe 4K5 (SEQ ID NO: 13) was used in that the corresponding sequence of the probe was predicted to bewithin the 1200 bp fragment if the fragment corresponded to the SPS sequence. The probe hybridized to the 1200 bp band generated by PCR using the primer set CD3 but not to PCR products generated by the primer set CD4 FIG. 5. 5.5 Isolation of SPSBacteriophage Lambda cDNA Clones
The 1200 bp PCR-generated fragment was labeled with .sup.32 P (as per the Random Primed DNA Labeling Kit, Boehringer Mannheim, Indianapolis, Ind.) and used as a probe to screen approximately 250,000 plaques of the cDNA library (5.3.). Theinserts of the positive clones were analyzed by restriction analysis with EcoRI, and the clones with the longest inserts, SPS#3 and SPS#18, were selected for further analysis. FIG. 6. A 0.4 kb HindIII/EcorRI fragment from the 5' end of SPS#3 wasisolated, then labeled with .sup.32 P by random priming (Random Primed DNA Labeling Kit) and used as a probe to re-screen the library. Another clone, designated SPS#61, which extends further upstream than SPS#3, was isolated, FIG. 6. DNA sequencingindicated that the 5' end of the SPS reading frame was not reached.
To isolate cDNA clones that included more of the 5' region than SPS#3 or SPS#61, a new cDNA library was prepared, as per Example 5.3., (RiboClone cDNA Synthesis System by Promega; Madison, Wis.) using M-MLV reverse transcriptase instead of AMVreverse transcriptase. However, instead of using oligo (dT) as a primer, a synthetic 17 bp primer, 23B, derived from the 5' sequence of the SPS#61 clone, was used (FIG. 6). This resulted in cDNAs that only contain regions upstream of the the SPS#61 5'region. The library was screened with the .sup.32 P-labeled EcoRI insert from SPS#61, and 16 positive clones were obtained. The clones with the longest inserts, SPS#77 and SPS#90, were selected for further analysis. DNA sequencing of SPS#77 and SPS#90showed that the region of overlap (greater than 100 bp) with SPS#61 was identical in all clones, and that both extend further upstream into the 5' region. FIG. 6
PCR was carried out using single-stranded cDNA (from a reverse transcriptase reaction corn leaf RNA (5.2.) primed with oligo (dT) T) as described above) as template and primers selected from the SPS#90 and SPS#3 sequences, confirmed that SPS#90and SPS#3 originate from the same mRNA transcript. The fragment resulting from this PCR reaction was 750 bp in length, consistent with the the size predicted from the DNA sequence. The 750 bp fragment was subcloned into a Bluescript-derived vector as aSalI/HindIII fragment. Four of the resulting subclones were partially sequenced, and the sequence obtained matched the existing DNA sequence. 5.6. Assembly of the SPS Reading Frame.
Both DNA strands of #90, #61, and #3 were sequenced, using the method of Sanger et al. (PNAS (1977) 74: 5463-5467). All three sequences can be combined to one contiguous sequence of 3509 bp, (SEQ ID NO: 6) FIG. 7A through FIG. 7J. Primerextension experiments using corn leaf poly(A) RNA and an antisense primer showed that the 5' end of our DNA sequence represents sequences form the actual 5' end of the SPS in RNA. In the SPS reading frame, as defined by the five peptide sequences A8,B4, B11, 4R and 12N (SEQ ID NOS. 1-5), respectively, (FIG. 3), the first methionine codons are located at bp 112 and bp 250. FIG. 7. The codon at bp 112 is similar to the consensus eukaryotic translational start site (Kozak, Cell (1986) 44: 283-292)and is located 54 bp downstream of a TAG stop codon (bp 58). It is proposed that this codon represents the translational start of the SPS polypeptide in vivo. After a 1068 codon reading frame, translation is stopped by TGA. The following 193 bpcontain the 3' untranslated region including a poly(A) addition signal, AAATAAA.
The full-length SPS coding region may be assembled by combining the 529 bp BamHI/HindIII fragment of SPS#90, the 705 bp HindIII fragment of SPS#61 and the 2162 bp HindIII/EcoRI fragment from SPS#3 (see FIG. 6). 6. Detection of SPS Polypeptidesby Specific Antisera
Samples of purified protein preparations obtained by the method described in 3.2.2. were subjected to SDS-PAGE electrophoresis. The proteins in the gel were fixed and stained. The bands corresponding to the 90 kd and 30 kd polypeptides wereexcised. With this material polyclonal antisera were raised in rabbits by conventional procedures. Western analysis (as described by Oberfelder, Focus (1989) 11(1):1-5) showed that the antibodies isolated from the rabbit immunized with SPS 30recognized the bands corresponding to the SPS 30 and SPS 120 peptides on a SDS PAGE gel, and that the antibodies isolated from the rabbit immunized with SPS 90 recognized the bands corresponding to the SPS 90 and SPS 120 polypeptides FIG. 8. 6.2. Immunological Localization of SPS in the Corn Plant
Total proteins were extracted from leaves of a 30 day-old corn plant, harvested at 11:00 AM, by boiling in SDS buffer. The protein extracts were loaded on duplicate SDS-PAGE gels. One gel was stained with Coomassie Blue, while the other wassubjected to Western analysis, using a mixture of SPS30 and SPS90 antisera as probe. FIG. 9A and FIG. 9B. The prominent bands appearing on the Coomasie Blue-stained gel were identified as phosphoenolpyruvate carboxylase (PEPcase), an enzyme involved inC4 photosynthesis. The Western blot showed the presence of the SPS band. The SPS protein pattern was very similar to the PEPcase protein pattern: not present in roots, and not present in the section of leaf closest to the stem, or in very young leaves. This pattern corresponds with expression associated with photosynthesis, and is the pattern expected for SPS. 7. Construction of Expression Constructs Plasmids 7.1. Construction of the full-length SPS reading frame
Clone SPS#90 is designated with HindIII and ligated with the 705 bp HindIII fragment from clone SPS#61 to create a plasmid containing the 5' end of the SPS coding region. The resulting plasmid is digested with BamHI and partially digested withHindIII, resulting in a 1340 bp BamHI/HindIII fragment containing the 5' end of the coding region. The 3' end of the SPS coding region is obtained by digestion of SPS#3 with EcoRI and partial digestion with HindIII, resulting in a 2162 bp HindIII/EcoRIfragment. This 2162 bp HindIII/EcoRI fragment, carrying the 3' end, is ligated with the 1340 BamHI/EcoRI fragment carrying the 5' end into a BamHI/EcoRI-digested pUC-derivative plasmid Bluescript, to create a plasmid carrying the entire 3403 bp SPScoding region and 3' untranslated transcription termination region. 7.2 Expression of SPS in E. coli
When cloning the 3403 bp BamHI/EcoRI SPS fragment into the plasmid Bluescript SK (Strategene, La Jolla, Calif.), a translational fusion between the plasmid coded lacZ sequence and the SPS reading frame is created. The resulting fusion proteincontains 30 N-terminal amino acids from the betagalactosidase and the complete SPS polypeptide. The fusion protein was expressed in E. coli under the Bluescribe plasmid lacZ promoter. Preparation of total protein followed by Western analysis using antiSPS antisera (6.1.) shows a band comigrating with native plant SPS. For SPS activity test the E. coli cells containing the SPS expression construct as described were opened with Lysozyme and sonication. Soluble protein was desalted by a Sephadex G-25column. This protein extract was assayed for SPS activity analogous to (1.1.a.) except the reagent anthrone was used instead of resovcinol (E. U. Handel, Analytical Biochemistry, (1968) 22:280-283). This test shows that the SPS protein, expressed fromthe cDNA in E. coli does have SPS enzyme activity. By comparison to native plant enzyme it seems to have the same specific activity. 7.3. Construction of the Tobacco Small Subunit (SSU)
Promoter-Transcriptional Fusions
The SPS coding region can be conveniently cloned as a BamHI/EcoRI (bp 106-bp 3506) fragment 3' of a tobacco small subunit promoter.
A SSU promoter for expression of the SPS coding region, may be prepared as follows. The SSU promoter region from PCGN627(described below) is opened by KDnI and the 3' overhang removed. After EcoRI digestion, the 3403 bp BamHI (filled in) EcoRISPS cDNA fragment (see, Example 7.1.) can be inserted.
After the SPS coding region is ligated into the SSU promoter, the SSU/SPS region may be ligated into a binary vector and integrated into a plant genome via Agrobacterium tumefaciens mediated transformation (The SPS region carries its owntranscription termination region in the cDNA sequence.) Insertion of the ssu/SPS construct into the binary vector pCGN1557 results in pCGN3812.
pCGN627
The 3.4 kb EcoRI fragment of TSSU3-8 (O'Neal et al., Nucleic Acids Res. (1987) 15:9661-8677), containing the small subunit promoter region, is cloned into the EcoRI site of M13mp18 (Yanisch-Perron et al., Gene (1985) 53:103-119) to yield an M13clone 8B. Single-stranded DNA is used as a template to extend oligonucleotide primer "Probe 1" (O'Neal et al., Nucleic Acids Research (1987) 15:8661-8677) using the Klenow fragment of DNA polymerase I. Extension products are treated with mung beannuclease and then digested with HindIII to yield a 1450 bp fragment containing the SSU promoter region. The fragment is closed into HindIII-SmaI-digested pUC18 (Yanisch-Perron et al., Gene (1985) 53: 103-119) to yield pCGN625. pCGN625 is digested withHindIII, the ends blunted with Klenow, and the digested plasmid re-digested with EcoRI. The =coRI/blunted-HindIII fragment containing the SSU promoter region is ligated with SmaI/EcoRI-digested pUC18 to yield pCGN627. 7.4. Construction of a CaMVPromoter - SPS Transcriptional Fusion
The 358 promoter DNA fragment from cauliflower mosaic virus can be fused to the SPS DNA as follows.
The plasmid pCNG639 can be opened by BamHI and EcoRI and the 3403 bp BamHI/EcoRI SPS cDNA fragment as described in Example 7.1 can be cloned into this plasmid. The hybrid gene can be removed from this plasmid as a 4.35 kb XbaI EcoRI fragment andligated into a binary vector (K. E. McBride and K. R. Summerfelt, Plant Mol. Bio. (1990) 14:269-276) and integrated into a plant genome via Agrobacterium tumefaciens mediated transformation. Insertion of the CaMV/SPS construct into the binary vectorpCGN1557 (McBride and Summerfelt supra) results in pCGN3815. 7.4.1. Construction of pCGN639
pCGN164 is digested with EcoRV and BamHI to release a EcoRV-BamHI fragment which contained a portion of the 35S promoter (bp 7340-7433). pCGN638 is digested with HindIII and EcoRV to release a HindIII-EcoRV fragment containing a differentportion of the 35S promoter (bp 6493-7340). These two fragments are ligated into pCGN986 which has been digested with HindIII and BamHI to remove the HindIII-Bam/HI fragment containing the 35S-promoter; this ligation produces pCGN639, which contains thebackbone and tml-3' region from pCGN986 and the two 35S promoter fragments from pCGN164 and pCGN638. 7.4.2. Construction of pCGN164
The AluI fragment of CaMV (bp 7144-7735) (Gardner et al., Nucl.Acids Res. (1981) 9:2871-2888) is obtained by digestion with AluI and cloned into the HindII site of M13mp7 (Vieira and Messing, Gene (1982) 19:259-268) to create c614. An coRIdigest of C614 produces the EcoRI fragment from C614 containing the 35S promoter which is cloned into the EcoRI site of pUCS (Vieira and Messing, supra) to produce pCGN146. To trim the promoter region, the BglII site (bp 7670) is treated with BglII andBal31 and subsequently a BglII linker is attached to the Bal31 treated DNA to produce pCGN147. pCGN147 is digested with EcoRI/HphI and the resulting EcoRI-HphI fragment containing the 35S promoter is ligated into EcoRI-SmaI digested M13mp8 (Vieira andMessing, supra) to create pCGN164. 7.4.3. Construction of pCGN638
Digestion of CaMV10 (Gardner, et al., Nucl. Acids Res. (1981) 9:2871-2888) with BglII produces a BglII fragment containing a 35S promoter region (bp 6493-7670) which is ligated into the BamHI site of pUC19. (Norrander et al., Gene (1983)26:101-106) to create pCGN638. 7.4.4. Construction of pCGN986
pCGN986 contains a cauliflower mosaic virus 35S (CaMV35) promoter and a T-DNA tml-3' region with multiple restriction sites between them. pCGN986 is derived from another cassette, pCGN206, containing a CaMV35S promoter and a different 3' region,the CaMV region VI 3'-end and pCGN971E, and tml 3' region.
pCGN148a containing a promoter region, selectable marker (kanamycin with 2 ATG's) and 3' region, is prepared by digesting pCGN528 with BglII and inserting the BamHI-BglII promoter fragment from pCGN147 (see above). This fragment is cloned intothe BglII site of pCGN528 so that the BglII site is proximal to the kanamycin gene of pCGN528.
The shuttle vector used for this construct pCGN528, is made as follows: pCGN525 was made by digesting a plasmid containing TnS, which harbors a kanamycin gene (Jorgensen et al., Mol. Gen. Genet. (1979) 177:65), with HindIII-BamHI and insertingthe HindIII-BamHI fragment containing the kinamycin resistance gene into the HindIII-BamHI sites in the tetracycline gene of pACYC184 (Chang and Cohen, J. Bacteriol. (1978) 134:1141-1156). pCGN526 was made by inserting the BamHI fragment 19 of pTiA6(Thomashow et al., Cell (1980) 19:729-739) modified with XhoI linkers inserted into the SmaI site, into the DamHi site of pCGN525. pCGN528 was obtained by deleting the small XhoI and religating.
pCGN149a is made by cloning the BamHI kanamycin gene fragment from pMB9KanXXI into the BamHI site of pCGN148a. pMB9KanXXI is a pUC4K variant (Vieira and Messing, Gene (1982) 19:259-268) which has the XhoI site missing but contains a functionkanamycin gene from Tn903 to allow for efficient selection in Agrobacterium.
pCGN149a is digested with HindIII and BamHi and ligated which pUC8 (Vieira and Messing, supra) digested with HindIII and BamHI to produce pCGN169. This removes the Tn903 kanamycin marker. pCGN565 and pCGN169 are both digested with HindIII andPstI and ligated to form pCGN203, a plasmid containing the CaMV 35S promoter and part of the 5'-end of the Tn5 kanamycin gene (up to the PstI site, (Jorgensen et al., Mol. Gen. Genet. (1979) 177:65). pCGN565 is a cloning vector based on pUC8-cm (K.Buckley, Ph.D. Thesis, UC San Diego 1985), but containing the polylinker from pUC18 (Yanisch-Perron et al., Gene (1985) 53:103-119).
A 3' regulatory region is added to pCGN203 from pCGN204 (as EcoRI fragment of CaMV (bp 408-6105) containing the region VI 3' cloned into pUC18 (Gardner et al., Nucleic Acids Res. (1981) 9:2871-2888) by digestion with HindIII and PstI andligation. The resulting cassette, pCGN206, is the basis for the construction of pCGN986.
The pTiA6 T-DNA tml 3'-sequences are subcloned from the Bam19T-DNA fragment (Thomashow et al., Cell (1980) 19:729-739) as a BamHI-EcoRI fragment (nucleotides 9062 to 12, 823, numbering as in (Barker et al., Plant Mo. Biol. (1983) 2:335-350) andcombined with the pACYC184 (Chang and Cohen, J. Bacteriol. (1978) 134:1141-1156) origin of replication as an EcoRI-HindIII fragment and a gentamycin resistance marker (from plasmid pLB41), (D. Figurski) as a BamHI-HindII fragment to produce pCGN417.
The unique SmaI site of pCGN417 (nucleotide 11,207 of the Bam19 fragment) is changed to a SacI site using linkers and the BamHI-SacI fragment is subcloned into pCGN565 to give pCGN971. The BamHI site of pCGN971 is changed to an EcoRI site usinglinkers to yield pCGN971E. The resulting EcoRI-SacI fragment of pCGN971E, containing the tml 3' regulatory sequence is joined to pCGN206 by digestion with EcoRI and SacI to give pCGN975. The small part of the Tn5 kanamycin resistance gene is deletedfrom the 3'-end of the CaMV 35S promoter by digestion with SalI and BglII, blunting the ends and ligating with SalI linkers. The final expression cassette pCGN986 contains the CaMV 35S promoter followed by two SalI sites, an XbaI site, BamHI, SmaI, KpnIand the tml 3' region (nucleotides 11207-9023 of the T-DNA).
Here under are indication schemes of the constructs.
TABLE I ##STR1##
TABLE II ##STR2##
TABLE III ##STR3## ##STR4## 8. Transgenic SPS Tomato Plants 8.1 Production of SPS "Sense" Transgenic Tomato Plants
Tomato plants are transformed and regenerated with expression cassettes containing SPS encoding sequences (pCGN3812 and pCGN3815) via Agrobacterium tumefaciens mediated transformation (Fillatti, et al., Bio/Technology (1987) 5:726-730). Preparation of pCGN3812, a tobacco SSU/SPS construct, and pCGN38115, a CaMV 35S/SPS construct are described in Examples 7.3 and 7.4, respectively. 8.2 Immunoblot Results
Leaves from transformed tomato plants (pCGN3812 and pCGN3815) and control tomato and corn leaves may be tested as described in Example 6.2 for SPS activity using the SPS30 and SPS90 peptide polyclonal antisera of Example 6. No cross reactivitybetween the antisera and the control (endogenous) tomato is seen. This indicates that the corn and tomato SPS are not highly related. As to the transgenic tomato plants, leaf extracts from plants containing the pCGN3815 or pCGN3818 constructs showsignals up to levels several times that observed by the untransformed corn leaf extracts. 8.3 SPS Activity
Leaf extracts are also tested for SPS activity according to the resorcinol protocol described in Example 1.1(a). In comparison of leaf extracts from control plants and transformed tomato plants containing the SPS gene, up to 12-fold increasesare observed. Higher SPS activity is also observed in some leaf extracts from transgenic tomato plants containing the corn SPS gene as compared to control corn leaf extracts. 8.4 Starch & Sucrose Levels
Leaf tissue is analyzed for starch and sucrose levels according to the method of (Haissig, B. E., et al., Physiol. Plan. (1979) 47:151-157). Two controls are used, leaves from a first untransformed plant and leaves from a transformant whichdoes not show any corn SPS immunoblot signal. The starch/sucrose levels of these two plants are essentially the same, having almost equal percentage of starch (mg/100 mg dry weight) and sucrose (mg/10 mg dry weight). High expressing plants containingpCGN3812 (pCGN3812-9 and pCGN3812-11) show both a reduction in leaf starch by 50% and an increase in sucrose levels by a factor of two. These data indicate that the presence of high levels of corn SPS in tomato leaves causes a modification ofcarbohydrate partitioning in this tissue.
SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 13 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi)SEQUENCE DESCRIPTION: SEQ ID NO: 1 Thr Trp Ile Lys 1 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQID NO: 2 Tyr Val Val Glu Leu Ala Arg 1 5 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 Ser Met Pro Pro Ile Trp Ala Glu Val Met Arg 1 5 10 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 14 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCE DESCRIPTION: SEQ IDNO: 4 Leu Arg Pro Asp Gln Asp Tyr Leu Met His Ile Ser His Arg 1 5 10 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (xi) SEQUENCEDESCRIPTION: SEQ ID NO: 5 Trp Ser His Asp Gly Ala Arg 1 5 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3509 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNAto mRNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6 GAATTCCGGC GTGGGCGCTG GGCTAGTGCT CCCGCAGCGA GCGATCTGAG AGAACGGTAG 60 AGTTCCGGCC GGGCGCGCGG GAGAGGAGGA GGGTCGGGCG GGGAGGATCC G ATG GCC 117 Met Ala 1 GGG AAC GAG TGG ATC AAT GGG TAC CTG GAG GCG ATC CTCGAC AGC CAC 165 Gly Asn Glu Trp Ile Asn Gly Tyr Leu Glu Ala Ile Leu Asp Ser His 5 10 15 ACC TCG TCG CGG GGT GCC GGC GGC GGC GGC GGC GGG GGG GAC CCC AGG 213 Thr Ser Ser Arg Gly Ala Gly Gly Gly Gly Gly Gly Gly Asp Pro Arg 20 25 30 TCG CCG ACG AAG GCGGCG AGC CCC CGC GGC GCG CAC ATG AAC TTC AAC 261 Ser Pro Thr Lys Ala Ala Ser Pro Arg Gly Ala His Met Asn Phe Asn 35 40 45 50 CCC TCG CAC TAC TTC GTC GAG GAG GTG GTC AAG GGC GTC GAC GAG AGC 309 Pro Ser His Tyr Phe Val Glu Glu Val Val Lys Gly Val AspGlu Ser 55 60 65 GAC CTC CAC CGG ACG TGG ATC AAG GTC GTC GCC ACC CGC AAC GCC CGC 357 Asp Leu His Arg Thr Trp Ile Lys Val Val Ala Thr Arg Asn Ala Arg 70 75 80 GAG CGC AGC ACC AGG CTC GAG AAC ATG TGC TGG CGG ATC TGG CAC CTC 405 Glu Arg Ser Thr ArgLeu Glu Asn Met Cys Trp Arg Ile Trp His Leu 85 90 95 GCG CGC AAG AAG AAG CAG CTG GAG CTG GAG GGC ATC CAG AGA ATC TCG 453 Ala Arg Lys Lys Lys Gln Leu Glu Leu Glu Gly Ile Gln Arg Ile Ser 100 105 110 GCA AGA AGG AAG GAA CAG GAG CAG GTG CGT CGT GAG GCGACG GAG GAC 501 Ala Arg Arg Lys Glu Gln Glu Gln Val Arg Arg Glu Ala Thr Glu Asp 115 120 125 130 CTG GCC GAG GAT CTG TCA GAA GGC GAG AAG GGA GAC ACC ATC GGC GAG 549 Leu Ala Glu Asp Leu Ser Glu Gly Glu Lys Gly Asp Thr Ile Gly Glu 135 140 145 CTT GCGCCG GTT GAG ACG ACC AAG AAG AAG TTC CAG AGG AAC TTC TCT 597 Leu Ala Pro Val Glu Thr Thr Lys Lys Lys Phe Gln Arg Asn Phe Ser 150 155 160 GAC CTT ACC GTC TGG TCT GAC GAC AAT AAG GAG AAG AAG CTT TAC ATT 645 Asp Leu Thr Val Trp Ser Asp Asp Asn Lys GluLys Lys Leu Tyr Ile 165 170 175 GTG CTC ATC AGC GTG CAT GGT CTT GTT CGT GGA GAA AAC ATG GAA CTA 693 Val Leu Ile Ser Val His Gly Leu Val Arg Gly Glu Asn Met Glu Leu 180 185 190 GGT CGT GAT TCT GAT ACA GGT GGC CAG GTG AAA TAT GTG GTC GAA CTT 741 GlyArg Asp Ser Asp Thr Gly Gly Gln Val Lys Tyr Val Val Glu Leu 195 200 205 210 GCA AGA GCG ATG TCA ATG ATG CCT GGA GTG TAC AGG GTG GAC CTC TTC 789 Ala Arg Ala Met Ser Met Met Pro Gly Val Tyr Arg Val Asp Leu Phe 215 220 225 ACT CGT CAA GTG TCA TCT CCTGAC GTG GAC TGG AGC TAC GGT GAG CCA 837 Thr Arg Gln Val Ser Ser Pro Asp Val Asp Trp Ser Tyr Gly Glu Pro 230 235 240 ACC GAG ATG TTA TGC GCC GGT TCC AAT GAT GGA GAG GGG ATG GGT GAG 885 Thr Glu Met Leu Cys Ala Gly Ser Asn Asp Gly Glu Gly Met Gly Glu 245 250 255 AGT GGC GGA GCC TAC ATT GTG CGC ATA CCG TGT GGG CCG CGG GAT AAA 933 Ser Gly Gly Ala Tyr Ile Val Arg Ile Pro Cys Gly Pro Arg Asp Lys 260 265 270 TAC CTC AAG AAG GAA GCG TTG TGG CCT TAC CTC CAA GAG TTT GTC GAT 981 Tyr Leu Lys Lys Glu AlaLeu Trp Pro Tyr Leu Gln Glu Phe Val Asp 275 280 285 290 GGA GCC CTT GCG CAT ATC CTG AAC ATG TCC AAG GCT CTG GGA GAG CAG 1029 Gly Ala Leu Ala His Ile Leu Asn Met Ser Lys Ala Leu Gly Glu Gln 295 300 305 GTT GGA AAT GGG AGG CCA GTA CTG CCT TAC GTG ATACAT GGG CAC TAT 1077 Val Gly Asn Gly Arg Pro Val Leu Pro Tyr Val Ile His Gly His Tyr 310 315 320 GCC GAT GCT GGA GAT GTT GCT GCT CTC CTT TCT GGT GCG CTG AAT GTG 1125 Ala Asp Ala Gly Asp Val Ala Ala Leu Leu Ser Gly Ala Leu Asn Val 325 330 335 CCAATG GTG CTC ACT GGC CAC TCA CTT GGG AGG AAC AAG CTG GAA CAA 1173 Pro Met Val Leu Thr Gly His Ser Leu Gly Arg Asn Lys Leu Glu Gln 340 345 350 CTG CTG AAG CAA GGG CGC ATG TCC AAG GAG GAG ATC GAT TCG ACA TAC 1221 Leu Leu Lys Gln Gly Arg Met Ser Lys GluGlu Ile Asp Ser Thr Tyr 355 360 365 370 AAG ATC ATG AGG CGT ATC GAG GGT GAG GAG CTG GCC CTG GAT GCG TCA 1269 Lys Ile Met Arg Arg Ile Glu Gly Glu Glu Leu Ala Leu Asp Ala Ser 375 380 385 GAG CTT GTA ATC ACG AGC ACA AGG CAG GAG ATT GAT GAG CAG TGG GGA1317 Glu Leu Val Ile Thr Ser Thr Arg Gln Glu Ile Asp Glu Gln Trp Gly 390 395 400 TTG TAC GAT GGA TTT GAT GTC AAG CTT GAG AAA GTG CTG AGG GCA CGG 1365 Leu Tyr Asp Gly Phe Asp Val Lys Leu Glu Lys Val Leu Arg Ala Arg 405 410 415 GCG AGG CGC GGG GTTAGC TGC CAT GGT CGT TAC ATG CCT AGG ATG GTG 1413 Ala Arg Arg Gly Val Ser Cys His Gly Arg Tyr Met Pro Arg Met Val 420 425 430 GTG ATT CCT CCG GGA ATG GAT TTC AGC AAT GTT GTA GTT CAT GAA GAC 1461 Val Ile Pro Pro Gly Met Asp Phe Ser Asn Val Val Val HisGlu Asp 435 440 445 450 ATT GAT GGG GAT GGT GAC GTC AAA GAT GAT ATC GTT GGT TTG GAG GGT 1509 Ile Asp Gly Asp Gly Asp Val Lys Asp Asp Ile Val Gly Leu Glu Gly 455 460 465 GCC TCA CCC AAG TCA ATG CCC CCA ATT TGG GCC GAA GTG ATG CGG TTC 1557 Ala SerPro Lys Ser Met Pro Pro Ile Trp Ala Glu Val Met Arg Phe 470 475 480 CTG ACC AAC CCT CAC AAG CCG ATG ATC CTG GCG TTA TCA AGA CCA GAC 1605 Leu Thr Asn Pro His Lys Pro Met Ile Leu Ala Leu Ser Arg Pro Asp 485 490 495 CCG AAG AAG AAC ATC ACT ACC CTC GTCAAA GCG TTT GGA GAG TGT CGT 1653 Pro Lys Lys Asn Ile Thr Thr Leu Val Lys Ala Phe Gly Glu Cys Arg 500 505 510 CCA CTC AGG GAA CTT GCA AAC CTT ACT CTG ATC ATG GGT AAC AGA GAT 1701 Pro Leu Arg Glu Leu Ala Asn Leu Thr Leu Ile Met Gly Asn Arg Asp 515 520525 530 GAC ATC GAC GAC ATG TCT GCT GGC AAT GCC AGT GTC CTC ACC ACA GTT 1749 Asp Ile Asp Asp Met Ser Ala Gly Asn Ala Ser Val Leu Thr Thr Val 535 540 545 CTG AAG CTG ATT GAC AAG TAT GAT CTG TAC GGA AGC GTG GCG TTC CCT 1797 Leu Lys Leu Ile Asp Lys TyrAsp Leu Tyr Gly Ser Val Ala Phe Pro 550 555 560 AAG CAT CAC AAT CAG GCT GAC GTC CCG GAG ATC TAT CGC CTC GCG GCC 1845 Lys His His Asn Gln Ala Asp Val Pro Glu Ile Tyr Arg Leu Ala Ala 565 570 575 AAA ATG AAG GGC GTC TTC ATC AAC CCT GCT CTC GTT GAG CCGTTT GGT 1893 Lys Met Lys Gly Val Phe Ile Asn Pro Ala Leu Val Glu Pro Phe Gly 580 585 590 CTC ACC CTG ATC GAG GCT GCG GCA CAC GGA CTC CCG ATA GTC GCT ACC 1941 Leu Thr Leu Ile Glu Ala Ala Ala His Gly Leu Pro Ile Val Ala Thr 595 600 605 610 AAG AATGGT GGT CCG GTC GAC ATT ACA AAT GCA TTA AAC AAC GGA CTG 1989 Lys Asn Gly Gly Pro Val Asp Ile Thr Asn Ala Leu Asn Asn Gly Leu 615 620 625 CTC GTT GAC CCA CAC GAC CAG AAC GCC ATC GCT GAT GCA CTG CTG AAG 2037 Leu Val Asp Pro His Asp Gln Asn Ala Ile AlaAsp Ala Leu Leu Lys 630 635 640 CTT GTG GCA GAC AAG AAC CTG TGG CAG GAA TGC CGG AGA AAC GGG CTG 2085 Leu Val Ala Asp Lys Asn Leu Trp Gln Glu Cys Arg Arg Asn Gly Leu 645 650 655 CGC AAC ATC CAC CTC TAC TCA TGG CCG GAG CAC TGC CGC ACT TAC CTC 2133 Arg Asn Ile His Leu Tyr Ser Trp Pro Glu His Cys Arg Thr Tyr Leu 660 665 670 ACC AGG GTG GCC GGG TGC CGG TTA AGG AAC CCG AGG TGG CTG AAG GAC 2181 Thr Arg Val Ala Gly Cys Arg Leu Arg Asn Pro Arg Trp Leu Lys Asp 675 680 685 690 ACA CCA GCA GAT GCC GGAGCC GAT GAG GAG GAG TTC CTG GAG GAT TCC 2229 Thr Pro Ala Asp Ala Gly Ala Asp Glu Glu Glu Phe Leu Glu Asp Ser 695 700 705 ATG GAC GCT CAG GAC CTG TCA CTC CGT CTG TCC ATC GAC GGT GAG AAG 2277 Met Asp Ala Gln Asp Leu Ser Leu Arg Leu Ser Ile Asp Gly GluLys 710 715 720 AGC TCG CTG AAC ACT AAC GAT CCA CTG TGG TTC GAC CCC CAG GAT CAA 2325 Ser Ser Leu Asn Thr Asn Asp Pro Leu Trp Phe Asp Pro Gln Asp Gln 725 730 735 GTG CAG AAG ATC ATG AAC AAC ATC AAG CAG TCG TCA GCG CTT CCT CCG 2373 Val Gln Lys IleMet Asn Asn Ile Lys Gln Ser Ser Ala Leu Pro Pro 740 745 750 TCC ATG TCC TCA GTC GCA GCC GAG GGC ACA GGC AGC ACC ATG AAC AAA 2421 Ser Met Ser Ser Val Ala Ala Glu Gly Thr Gly Ser Thr Met Asn Lys 755 760 765 770 TAC CCA CTC CTG CGC CGG CGC CGG CGC TTGTTC GTC ATA GCT GTG GAC 2469 Tyr Pro Leu Leu Arg Arg Arg Arg Arg Leu Phe Val Ile Ala Val Asp 775 780 785 TGC TAC CAG GAC GAT GGC CGT GCT AGC AAG AAG ATG CTG CAG GTG ATC 2517 Cys Tyr Gln Asp Asp Gly Arg Ala Ser Lys Lys Met Leu Gln Val Ile 790 795 800 CAG GAA GTT TTC AGA GCA GTC CGA TCG GAC TCC CAG ATG TTC AAG ATC 2565 Gln Glu Val Phe Arg Ala Val Arg Ser Asp Ser Gln Met Phe Lys Ile 805 810 815 TCA GGG TTC ACG CTG TCG ACT GCC ATG CCG TTG TCC GAG ACA CTC CAG 2613 Ser Gly Phe Thr Leu Ser Thr Ala MetPro Leu Ser Glu Thr Leu Gln 820 825 830 CTT CTG CAG CTC GGC AAG ATC CCA GCG ACC GAC TTC GAC GCC CTC ATC 2661 Leu Leu Gln Leu Gly Lys Ile Pro Ala Thr Asp Phe Asp Ala Leu Ile 835 840 845 850 TGT GGC AGC GGC AGC GAG GTG TAC TAT CCT GGC ACG GCG AAC TGCATG 2709 Cys Gly Ser Gly Ser Glu Val Tyr Tyr Pro Gly Thr Ala Asn Cys Met 855 860 865 GAC GCT GAA GGA AAG CTG CGC CCA GAT CAG GAC TAT CTG ATG CAC ATC 2757 Asp Ala Glu Gly Lys Leu Arg Pro Asp Gln Asp Tyr Leu Met His Ile 870 875 880 AGC CAC CGC TGGTCC CAT GAC GGC GCG AGG CAG ACC ATA GCG AAG CTC 2805 Ser His Arg Trp Ser His Asp Gly Ala Arg Gln Thr Ile Ala Lys Leu 885 890 895 ATG GGC GCT CAG GAC GGT TCA GGC GAC GCT GTC GAG CAG GAC GTG GCG 2853 Met Gly Ala Gln Asp Gly Ser Gly Asp Ala Val Glu GlnAsp Val Ala 900 905 910 TCC AGT AAT GCA CAC TGT GTC GCG TTC CTC ATC AAA GAC CCC CAA AAG 2901 Ser Ser Asn Ala His Cys Val Ala Phe Leu Ile Lys Asp Pro Gln Lys 915 920 925 930 GTG AAA ACG GTC GAT GAG ATG AGG GAG CGG CTG AGG ATG CGT GGT CTC 2949 ValLys Thr Val Asp Glu Met Arg Glu Arg Leu Arg Met Arg Gly Leu 935 940 945 CGC TGC CAC ATC ATG TAC TGC AGG AAC TCG ACA AGG CTT CAG GTT GTC 2997 Arg Cys His Ile Met Tyr Cys Arg Asn Ser Thr Arg Leu Gln Val Val 950 955 960 CCT CTG CTA GCA TCA AGG TCA CAGGCA CTC AGG TAT CTT TCC GTG CGC 3045 Pro Leu Leu Ala Ser Arg Ser Gln Ala Leu Arg Tyr Leu Ser Val Arg 965 970 975 TGG GGC GTA TCT GTG GGG AAC ATG TAT CTG ATC ACC GGG GAA CAT GGC 3093 Trp Gly Val Ser Val Gly Asn Met Tyr Leu Ile Thr Gly Glu His Gly 980985 990 GAC ACC GAT CTA GAG GAG ATG CTA TCC GGG CTA CAC AAG ACC GTG ATC 3141 Asp Thr Asp Leu Glu Glu Met Leu Ser Gly Leu His Lys Thr Val Ile 995 1000 1005 1010 GTC CGT GGC GTC ACC GAG AAG GGT TCG GAA GCA CTG GTG AGG AGC CCA 3189 Val Arg Gly Val ThrGlu Lys Gly Ser Glu Ala Leu Val Arg Ser Pro
1015 1020 1025 GGA AGC TAC AAG AGG GAC GAT GTC GTC CCG TCT GAG ACC CCC TTG GCT 3237 Gly Ser Tyr Lys Arg Asp Asp Val Val Pro Ser Glu Thr Pro Leu Ala 1030 1035 1040 GCG TAC ACG ACT GGT GAG CTG AAG GCC GAC GAG ATC ATG CGG GCT CTG 3285 Ala TyrThr Thr Gly Glu Leu Lys Ala Asp Glu Ile Met Arg Ala Leu 1045 1050 1055 AAG CAA GTC TCC AAG ACT TCC AGC GGC ATG TGAATTTGAT GCTTCTTTTA 3335 Lys Gln Val Ser Lys Thr Ser Ser Gly Met 1060 1065 CATTTTGTCC TTTTCTTCAC TGCTATATAA AATAAGTTGT GAACAGTACCGCGGGTGTGT 3395 ATATATATAT TGCAGTGACA AATAAAACAG GACACTGCTA ACTATACTGG TGAATATACG 3455 ACTGTCAAGA TTGTATGCTA AGTACTCCAT TTCTCAATGT ATCAATCGGA ATTC 3509 (2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 33 base pairs (B)TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: possible peptide encoding sequences (iii) HYPOTHETICAL: Y (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7 WSNATGCCNC CNATHTGGGCNGARGTNATG MGN 33 (2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: possiblepeptide encoding sequences (iii) HYPOTHETICAL: Y (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 YTNMGNCCNG AYCARGAYTA YYTNATGCAY ATHWSNCAYM GN 42 (2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleicacid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: synthetic oligonucleotide mixture (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9 ATGCCNCCNA THTGGGCNGA 20 (2) INFORMATION FOR SEQ ID NO: 10: (i)SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: synthetic oligonucleotide mixture (xi) SEQUENCE DESCRIPTION: SEQ IDNO: 10 TGCATNAGRT ARTCYTGRTC 20 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A)DESCRIPTION: synthetic oligonucleotide mixture (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 TCNGCCCADA TNGGNGGCAT 20 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS:single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: synthetic oligonucleotide mixture (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12 GAYCARGAYT AYCTNATGCA 20 (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCECHARACTERISTICS: (A) LENGTH: 14 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: other nucleic acid (A) DESCRIPTION: synthetic oligonucleotide mixture (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13 TGRTCNGGNC KNAR 14
* * * * * |
|
|
|
 |
|
 |
|
| |
Randomly Featured Patents |
|