Resources Contact Us Home
Browse by: INVENTOR PATENT HOLDER PATENT NUMBER DATE
 
 
Soluble polypeptide fractions of the LAG-3 protein, production method, therapeutic composition, anti-idiotype antibodies
RE38313 Soluble polypeptide fractions of the LAG-3 protein, production method, therapeutic composition, anti-idiotype antibodies

Patent Drawings:
Inventor: Faure, et al.
Date Issued: November 11, 2003
Application: 09/931,103
Filed: August 17, 2001
Inventors: Faure; Florence (Paris, FR)
Hercend; Thierry (Cambridge, MA)
Huard; Bertrand (St Cergues, FR)
Triebel; Frederic (Versailles, FR)
Assignee: Applied Research System ARS Holding N.V. (Curacao, NL)
Primary Examiner: Saunders; David
Assistant Examiner:
Attorney Or Agent: Browdy and Neimark, PLLC
U.S. Class: 435/455; 435/69.1; 530/324; 530/330; 530/350; 530/387.3; 530/391.3; 530/391.7; 530/861
Field Of Search: 435/69.1; 435/455; 530/324; 530/330; 530/350; 530/387.3; 530/391.3; 530/391.7; 530/861
International Class:
U.S Patent Documents: 5773578; 5874250; 5976877
Foreign Patent Documents: 0325224; WO 91/08298; WO 91/10682; WO 92/00092
Other References: Peppel et al., "A tumor necrosis factor (TNF) receptor-IgG Heavy chain chimeric protein as a bivalent antagonist of TNF activity", J. Exp.Med., 174:1483-1488 (1991)..
Loetscher et al., "Recombinant 55-kDa tumor necrosis factor (TNF) receptor stoichiometry of binding to TNF.alpha. and TNF.beta. and inhibition of TNF activity", The Journal of Biological Chemistry, 266:18324-18329 (1991)..
Biaxeras et al., "Characterizaton of the lymphocyte activation gene 3-encoded protein. A new ligand for human leukocyte antigen class II antigens", The Journal of Experimental Medicine, 176(2)327-337, New York (Aug. 1992)..
Triebel et al., "LAG-3, a novel lymphocyte activation gene closely related to CD4", The Journal of Experimental Medicine, 171(5)1393-1405 (May 1990)..
Bertrand et al., "The lymphocyte activation gene product LAG-3 is a ligand for class II antigens" 8 International Congress of Immunology. Abstracts, p. 281, Budapest (Aug. 1992)..
Huard et al., "Cellular expression and tissue distribution of the human LAG-3-encoded protein, an MHC class II ligand", Immunogenetics, 39(3)213-217, New York (Mar. 1994)..
Eilat et al., Proc. Natl. Acad. Sci. (USA), 89(15):6871-6875 (Aug. 1, 1992)..
De Santes et al., Cancer Research, 52:1916-1923 (Apr. 1, 1992)..
Taetle et al., J. Natl. Cancer Inst., 80(13):1053-1059 (Sep. 7, 1988)..

Abstract: Soluble polypeptide fraction consisting of all or part .[.one.]. .Iadd.of .Iaddend.at least .Iadd.one .Iaddend.of the four immunoglobulin-type extracellular LAG-3 protein domains (amino acids 1-159, 160-.[.230.]. .Iadd.239.Iaddend., 240-330 and 331-412 of the SEQ ID NO:1 sequence) or consisting of one peptide sequence derived from these domains by replacement, addition or deletion of one or more amino acids. The fraction of the invention has a specificity at least equal to that of LAG-3 in relation to its ligand.
Claim: We claim: .[.

1. A soluble polypeptide fraction consisting of at least one of the 4 immunoglobulin type extra-cellular domains of the LAG-3 protein (amino acids 1 to 4, 5 to 239, 240 to 330 and331 to 412 of sequence SEQ ID NO:1), wherein one or more arginine (Arg) residues at positions 73, 75 and 76 of SEQ ID NO:1 are substituted with glutamic acid (Glu) and said at least one extra-cellular domain of LAG-3 protein is optionally fused to asupplementary peptide sequence as a fusion protein..].

2. A soluble polypeptide .[.fraction.]. according to claim .[.1.]. .Iadd.11.Iaddend., further bound to a toxin or a radioisotope..[.

3. A soluble polypeptide fraction according to claim 1, further bound to a toxin or a radioisotope wherein said supplementary peptide sequence is present and comprises a portion of an immunoglobulin..].

4. A soluble polypeptide .[.fraction.]. according to claim .[.3.]. .Iadd.13.Iaddend., wherein said supplementary peptide sequence comprises a portion of an immunoglobulin of IgG4 isotype.

5. A method for producing the soluble polypeptide .[.fraction.]. of claim .[.1.]. .Iadd.11.Iaddend., which soluble polypeptide .[.fraction.]. further comprises a portion of an immunoglobulin, comprising .[.the steps of.]. : inserting a DNAmolecule comprising a fusion of fragments of cDNA coding for the polypeptide regions corresponding to LAG-3 or derived from LAG3 with cDNA coding for the portion of the immunoglobulin; transfecting the DNA molecule into a host expression system; andproducing the soluble polypeptide .[.fraction.]. by expression in the host. .[.

6. A soluble polypeptide fraction consisting of at least one of four immunoglobulin-type extracellular domains of LAG-3 protein corresponding to amino acid residues 1-4, 5-239, 240-330, and 331-412 of SEQ ID NO:1, fused to a supplementarypeptide sequence as a fusion protein..]..[.

7. A soluble polypeptide fraction according to claim 6, further bound to a toxin or a radioisotope..]..[.

8. A soluble polypeptide fraction according to claim 6, further bound to a toxin or a radioisotope wherein said supplementary peptide sequence comprises a portion of an immunoglobulin..]..[.

9. A soluble polypeptide fraction according to claim 8, wherein said supplementary peptide sequence comprises a portion of an immunoglobulin of IgG4 isotype..]..[.

10. A method for producing the soluble polypeptide fraction of claim 6, which soluble polypeptide fraction further comprises a portion of an immunoglobulin, comprising the steps of: inserting a DNA molecule comprising a fusion of fragments ofcDNA coding for the polypeptide regions corresponding to LAG-3 with cDNA coding for the portion of the immunoglobulin; transfecting the DNA molecule into a host expression system; and producing the soluble polypeptide fraction by expression in thehost..]. .Iadd.

11. A soluble polypeptide comprising a first immunoglobulin type extracellular domain of LAG-3 protein (amino acid residues 1-159 of SEQ ID NO:1), wherein one or more arginine (Arg) residues at positions 73, 75 and 76 of SEQ ID NO:1 aresubstituted with glutamic acid (Glu)..Iaddend..Iadd.

12. A soluble polypeptide according to claim 11, further comprising a supplementary peptide sequence fused to said first extracellular domain of LAG-3 protein as a fusion protein..Iaddend..Iadd.

13. A soluble polypeptide according to claim 12, wherein said supplementary peptide sequence comprises a portion of an immunoglobulin..Iaddend..Iadd.

14. A soluble polypeptide according to claim 11, wherein said first extracellular domain of LAG-3 protein is fused to one or more additional immunoglobulin type extracellular domains of LAG-3 protein selected from the group consisting of aminoacid residues 160-239, 240-330, and 331-412 of SEQ ID NO:1..Iaddend..Iadd.

15. A soluble polypeptide according to claim 14, further comprising a supplementary peptide sequence fused to either said first extracellular domain of LAG-3 protein or one of said one or more additional extracellular domains of LAG-3protein..Iaddend.
Description: BACKGROUND OF THE INVENTION

1. Field of the Invention

The invention relates to soluble forms derived from the LAG-3 membrane protein which are useful as immunosuppressants, as well as antibodies capable of preventing the specific binding of the LAG-3 protein to MHC (major histocompatibility complex)Class II molecules as immunostimulants.

2. Description of the Related Art

In WO-A 91/10682, a protein designated LAG-3 has been described.

The LAG-3 protein is a protein selectively expressed by NK cells and activated T lymphocytes. Similarity of the amino acid sequence, the comparative exon/intron organization and the chromosomal localization show that LAG-3 is related to CD4. The initial characterization of the LAG-3 gene has been described by TRIEBEL et al. (1).

The corresponding DNA codes for a type I transmembrane protein of 498 amino acids containing 4 extra-cellular sequences of the immunoglobulin type. LAG-3 is a member of the immunoglobulin superfamily.

The mature protein comprises 476 amino acids (SEQ ID No. 1) with a theoretical molecular weight of 52 kD. The extracellular region contains 8 cysteine residues and 4 potential N-glycosylation sites. By Western blot analysis, it was shown thatLAG-3 inside PRA-blasts or activated NK cells has an apparent mass Mr of 70,000. After treatment with N-glycosidase F, a reduction in size to 60 kD was obtained, thereby demonstrating that native LAG-3 is glycosylated. Fuller details are described inWO-A 91/10682.

BAIXERAS et al., in J. Exp. Med. 176, 327-337 (2), have, in addition, described their finding that rosette formation between cells transfected with LAG-3 (expressing LAG-3 at their surface) and B lymphocytes expressing MHC Class II wasspecifically dependent on LAG-3/MHC Class II interaction.

Surprisingly, this ligand for MHC Class II was detected with higher levels on activated CD8.sup.+ lymphocytes (MHC Class I-restricted) than on activated CD4.sup.+ lymphocytes. In vivo, only a few disseminated LAG-3.sup.+ cells (MHC ClassII-restricted) were to be found in non-hyperplastic lymphoid tissue comprising the primary lymphoid organs, that is to say thymus and bone marrow. LAG-3.sup.+ cells were to be found in hyperplastic lymphoid nodules and tonsils, as well as amongperipheral blood mononuclear cells (PBMC) of patients receiving injections of high doses of IL-2.

These observations confirm that LAG-3 is an activation antigen in contrast to CD4 expressed in a subpopulation of resting lymphocytes and other cell types, in particular macrophages.

The MHC comprises Class I and Class II molecules which are membrane glycoproteins which present fragments of protein antigens to the T lymphocyte receptors (TCR). Class I molecules are responsible for the presentation to CD8.sup.+ cytotoxiccells of peptides derived in large part from endogenously synthesized proteins, while Class II molecules present to CD4.sup.+ helper lymphocytes peptides originating in the first place from foreign proteins which have entered the endocytic, that is tosay exogenous, pathway. T helper lymphocytes regulate and amplify the immune response, while cytotoxic lymphocytes are needed to destroy cells irrespective of the tissues expressing "non-self" antigens, for example viral antigens. The mechanism ofrecognition involves intercellular signals leading to an effective activity of T lymphocytes.

It is apparent that, to initiate an immune response mediated by T (CD4.sup.+) lymphocytes, the foreign antigens must be captured and internalized in the form of peptides by specialized cells, the antigen presenting cells (APC). The resultingantigenic peptides are reexpressed at the surface of the antigen presenting cells, where they are combined with MHC Class II molecules. This MHC Class .[.I.]. .Iadd.II.Iaddend./peptide complex is specifically recognized by the T lymphocyte receptor,resulting in an activation of the T helper lymphocytes.

Moreover, animal models created by recombination techniques have made it possible to emphasize the part played in vivo by MHC Class II molecules and their ligands.

Thus, mice deficient in MHC Class II molecules (3) and possessing almost no peripheral CD4.sup.+ T lymphocytes and having only a few immature CD4.sup.+ lymphocytes in the thymus have proved to be completely incapable of responding to T-dependentantigens.

CD4.sup.- /.sup.- mutant mice (4) have a substantially decreased T lymphocyte activity but show normal development and function of the CD8.sup.+ T lymphocytes, demonstrating that the expression of CD4 on the daughter cells and CD4.sup.+ CD8.sup.+thymocytes is not obligatory for the development. Compared to normal mice, these CD4-deficient mice have a large amount of CD4.sup.- CD8.sup.- cells.

These doubly negative cells are restricted to MHC Class II and capable of recognizing the antigen.

When they are infected with Leishmania, these mice show a population of functional T helper lymphocytes despite the absence of CD4. These cells are restrictive to MHC Class II and produce interferon-.gamma. when they are activated by theantigen. This indicates that the lineage of the T lymphocytes and their peripheral function need not necessarily depend on the function of CD4.

It is now recognized that the proteins encoded by MHC Class II region are involved in many aspects of immune recognition, including the interaction between different lymphoid cells such as lymphocytes and antigen presenting cells. Differentobservations have also shown that other mechanisms which do not take place via CD4 participate in the effector function of T helper lymphocytes.

These different observations underline the pivotal role played by MHC Class II and its ligands in the immune system.

Moreover, the importance is known of chimeric molecules composed of the extracytoplasmic domain of proteins capable of binding to ligands and a constant region of human immunoglobulin (Ig) chains for obtaining soluble forms of proteins and ofcell receptors which are useful, in particular, as therapeutic agents.

Thus, soluble forms of CD4 have proven their efficacy in inhibiting an HIV infection in vitro in a dose-dependent manner.

Nevertheless, clinical trials with soluble CD4 molecules, in particular of CD4-Ig, have not enabled a significant decrease in viral titres to be demonstrated. Transgenic mice expressing up to 20 .mu.g/ml of soluble CD4 in their serum werecreated. These mice showed no difference as regards their immune function relative to control mice. Hitherto, no direct biding to MHC Class II of molecules derived from CD4 has been reported. This strongly suggests that soluble CD4 molecules do notinteract in vivo with MHC Class II molecules.

SUMMARY OF THE INVENTION

Surprisingly, the authors of the present invention have shown that soluble molecules containing different fragments of the extracytoplasmic domain of the LAG-3 protein were capable of binding to MHC Class II molecules and of having animmunosuppressant action.

The extracytoplasmic region of LAG-3 represented by the sequence SEQ ID No. 1 comprises the domains D1, D2, D3 and D4 extending from amino acids 1 to 159, 160 to 239, 240 to 330 and 331 to 412, respectively.

Thus, the subject of the invention is a soluble polypeptide fraction consisting of all or part of at least one of the 4 immunoglobulin type extracellular domains of the LAG-3 protein (amino acid 1 to 159, 160 to 239, 240 to 330 and 331 to 412 ofthe sequence SEQ ID No. 1), or of a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possesses a specificity at least equal to or greater than that of LAG-3 for its ligand.

The present invention encompasses, in particular, soluble polypeptide fractions having a sequence derived from the native LAG-3 sequence originating from the well-known phenomenon of polytypy.

The soluble polypeptide fraction is characterized in that it comprises the peptide region of LAG-3 responsible for the affinity of LAG-3 for MHC Class II molecules.

The soluble polypeptide fraction comprises, in particular, a peptide sequence derived from these domains by replacement, addition and/or deletion of one or more amino acids, and which possess a specificity equal to or greater than that of LAG-3for its ligand, for example the whole of the first two immunoglobulin type domains of LAG-3, or the 4 immunoglobulin type domains of the extracytoplasmic domain of LAG-3.

Advantageously, the soluble polypeptide fraction is comprised of all or part of at least one of the four immunoglobulin type extracellular domains of the LAG-3 protein (amino acid 1 to .[.149, 150.]. .Iadd.159, 160 .Iaddend.to 239, 240 to 330and 331 to 412 of sequence SEQ ID No. 1) comprising one or more of the arginine (Arg) rests at the positions 73, 75 and 76 of sequence SEQ ID No. 1 substituted with glutamic acid (Glu).

Preferably, the soluble polypeptide fraction comprises a loop in which the average position of the atoms forming the basic linkage arrangement is given by the position of amino acids 46 to 77 (SEQ ID No. 1) appearing in Table 1 or Table 2 ordiffers therefrom by not more than 5%.

The soluble polypeptide fraction advantageously comprises, in addition, the second immunoglobulin type extracellular domain (D2) of LAG-3 (amino acids .[.150.]. .Iadd.160 .Iaddend.to .[.241.]. .Iadd.239.Iaddend.).

Advantageously, the soluble polypeptide fraction comprises, besides the peptide sequence of LAG-3 as defined above, a supplementary peptide sequence at its C-terminal and/or N-terminal end, so as to constitute a fusion protein. The term "fusionprotein" means a portion of any protein permitting modification of the physicochemical features of the subfragments of the extracytoplasmic domain of the LAG-3 protein. Examples of such fusion proteins contain fragments of the extracytoplasmic domain ofLAG-3 as are defined above, bound to the heavy chain --CH2--CH3 junction region of a human immunoglobulin, preferably an isotype IgG4 immunoglobulin.

Such fusion proteins may be dimeric or monomeric. These fusion proteins may be obtained by recombination techniques well known to a person skilled in the art, for example a technique such as that described by Traunecker et al. (5).

Generally speaking, the method of production of these fusion proteins comprising an immunoglobulin region fused with a peptide sequence of LAG-3 as defined above consists in inserting into a vector the fragments of cDNA coding for the polypeptideregions corresponding to LAG-3 or derived from LAG-3, where appropriate after amplification by PCR, and the cDNA coding for the relevant region of the immunoglobulin, this cDNA being fused with cDNA coding for the corresponding polypeptide regions orderivatives of LAG-3, and in expressing after transfection the fragments cDNA in an expression system, in particular mammalian cells, for example hamster ovary cells.

The fusion proteins according to the invention may also be obtained by cleavage of a LAG-3/ Ig conjugate constructed so as to contain a suitable cleavage site.

The subject of the invention is also a therapeutic composition having immunosuppressant activity comprising a soluble polypeptide fraction according to the invention. This composition will be useful for treating pathologies requiringimmunosuppression, for example autoimmune diseases.

The subject of the invention is also the use of antibodies directed against LAG-3 or soluble polypeptide fractions derived from LAG-3 as are defined above, or fragments of such antibodies, in particular the Fab, Fab' and F(ab').sub.2 fragments,for the preparation of a therapeutic composition having immunostimulatory activity. "Immunostimulatory" means a molecular entity capable of stimulating the maturation, differentiation, proliferation and/or function of cells expressing LAG-3, that is tosay T lymphocytes or active NK cells. The anti-LAG-3 antibodies may be used as potentiators of vaccines or immunostimulants in immunosuppressed patients, such as patients infected with HIV or treated with immunosuppressant substances, or be used tostimulate the immune system by elimination of self cells displaying abnormal behaviour, for example cancer cells.

Immunostimulatory activity of anti-LAG-3 anti-bodies is surprising, inasmuch as anti-CD4 antibodies have an immunosuppressant action.

Such antibodies may be polyclonal or monoclonal; however, monoclonal antibodies are preferred. The polyclonal antibodies may be prepared according to well-known methods, such as that described by BENEDICT A. A. et al. (6). Monoclonal antibodiesare preferred, on account of the fact that they are specific for a single epitope and yield results with better reproducibility. Methods of production of monoclonal antibodies are well known from the prior art, especially the one described by KOHLER andMILSTEIN. This method, together with variants thereof, are described by YELTON et al. (7).

The subject of the invention is also anti-idiotype antibodies directed against the antibodies according to the invention, which contain the internal image of LAG-3 and are consequently capable of binding to MHC Class II. Such antibodies may beused, in particular, as immunosuppressants, and, for example, in autoimmune pathologies.

The therapeutic compositions according to the present invention comprise soluble LAG-3 proteins or antibodies as are defined above, as well as a pharmaceutically acceptable vehicle. These compositions may be formulated according to the usualtechniques. The vehicle can vary in form in accordance with the chosen administration route: oral, parenteral, sublingual, rectal or nasal.

For the compositions for parenteral administration, the vehicle will generally comprise sterile water as well as other possible ingredients promoting the solubility of the composition or its ability to be stored. The parenteral administrationroutes can consist of intravenous, intramuscular or subcutaneous injections.

The therapeutic composition can be of the sustained-release type, in particular for long-term treatments, for example in autoimmune diseases. The dose to be administered depends on the subject to be treated, in particular on the capacity ofhis/her immune system to achieve the desired degree of protection. The precise amounts of active ingredient to be administered may be readily determined by the practitioner who will initiate the treatment.

The therapeutic .[..compositions.]. .Iadd.compositions .Iaddend.according to the invention can comprise, in addition to soluble LAG-3 or the antibodies according to the invention, another active ingredient, where .[.apprto LAG-3 or to anmical.]. .Iadd.appropriate, bound via a chemical .Iaddend.bond to LAG-3 or to an antibody according to the invention. As an example, there may be mentioned soluble LAG-3 proteins according to the invention fused to a toxin, for example ricin or diphtheriatoxoid, capable of binding to MHC Class II molecules and of killing the target cells, for example leukaemic or melanoma cells, or fused to a radioisotope.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows a comparison of the proliferation of T cells incubated with F(ab) fragments of 17B4 to the proliferation of T cells incubated with intact 17B4 monoclonal antibody.

FIG. 2 shows the proliferation of Clone 28 in response to tetanus toxoid when co-cultured with 17B4 or control antibody 10H3.

FIG. 3 shows the expression vector pCDM7 used for manufacturing the recombinant LAG-3 proteins and a recombinant CD8 immunoadhesin control.

FIG. 4 shows the pCLH3 AXS V2 DHFR h.alpha. IVS vector used to express amplified LAG-3 sequences.

FIG. 5A shows the inhibition of MHC Class II interaction with LAG-3 by recombinant LAG-3 D1-D4 and FIG. 5B shows the potential inhibition of MHC Class II interaction with CD4.

FIG. 6 shows the inhibition of Clone 28 proliferation by recombinant LAG-3 D1-D4.

FIG. 7 shows the inhibition of Clone 154 proliferation by LAG-3 Ig.

FIG. 8 shows the binding of LAG-3 to B cell lines expressing MHC class II haplotypes or human class II-transfected mouse cells.

FIG. 9 shows the binding of LAG-3 Ig to MHC Class II expressing Daudi cells.

FIG. 10 shows that preincubation of HLA class II expressing cells with 17B4 inhibits LAG-3 Ig binding.

FIGS. 11A-11C show the inhibition of clone T154 proliferation by crosslinked LAG-3 Ig.

FIG. 12 compares inhibition of T cell proliferation by anti-Class II antibodies to inhibition of T cell proliferation by LAG-3 Ig.

FIGS. 13A-13D show that T cell proliferation in response to OKT3 (FIG. 13A), lectins (FIG. 13B) and low-concentration IL.sub.2 (FIG. 13C) is inhibited by LAG-3 Ig but proliferation in response to high-concentration IL.sub.2 is not inhibited byLAG-3 Ig (FIG. 13D).

FIG. 14 shows clone S1B5 cytotoxicity towards Epstein-Barr virus transformed human B cells.

FIG. 15 shows peripheral blood lymphocyte cytotoxicity towards HLA Class I.sup.- Daudi cells.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The examples which follow, together with the attached reference figures, will illustrate the invention in greater detail.

EXAMPLE 1

Proliferation of active T lymphocyte lines in the presence of anti-LAG-3 monoclonal antibodies

The anti-LAG-3 monoclonal antibodies used were 17B4, described in BAIXERAS et al. (2) and deposited at the CNCM under No. I-1240 on Jul. 10, 1992, and 11E3, described in HUARD et al. (8).

These antibodies belong to the isotype IgG1. These antibodies were tested for their biological effects on activated T lymphocytes, stimulated by specific antigenic peptides or processed antigens presented by MHC Class II molecules expressed byautologous antigen presenting cells, expressing LAG-3.

An anti-CD48 monoclonal antibody designated 10 H3 was used as irrelevant IgG1 antibody (negative control).

The saturating concentrations of anti-LAG-3 and anti-CD48 antibodies were determined by immunofluorescence on PHA (phytohaemagglutinin)-blasts and cell lines transformed by Epstein-Barr virus (EBV). In the proliferation tests, the monoclonalantibodies were added in the proportion of 5 times the saturating concentration.

The T lymphocyte lines used were, on the one hand the clone 154 derived from peripheral blood lymphocytes, raised against a peptide mimicking an influenza haemagglutinin (HA) fragment having an amino acid sequence extending from amino acid 306 to329 (p20 peptide), and on the other hand the clone 28, a T lymphocyte clone derived from peripheral lymphocytes of a single human donor, raised against diphtheria toxoid (DT). The antigen presenting cells (APC) corresponding to clone 154 wereEBV-transformed B lymphocytes of the same donor (DR3/DR11) as T 154. The antigen presenting cells corresponding to clone 28 were EBV-transformed B lymphocytes of the same donor. This clone was restricted to HLA DR7.

For clone 154, the APC (5.times.10.sup.6) were incubated at 37.degree. C. for one and a half hours with variable doses of the p20 peptide, then washed and irradiated (10,000 rad). The cells were plated out on 96-well microtitration plates atthe same time as the clone 154 cells (0.5.times.10.sup.5 to 10.times.10.sup.5 cells/ml) in a 3:1 ratio. For clone 28, the responding cells/stimulating cells ratio was 1.

The HLA DR7/EBV APC cells were either treated with mitomycin or irradiated, then added to the T lymphocytes in the presence of DT (which remained in the culture). The final concentration of clone 28 cells was 100,000 cells/ml.

[.sup.3 H]Thymidine (1 .mu.Ci/well) was added at varying time intervals from day 2 to day 10 of culture.

Each experiment was carried out in triplicate.

The results were expressed as the mean cpm and after subtraction of the cpm found in the negative control (T lymphocytes cocultured with APC unladen with immunogens). The proliferation tests were carried out on 96-well plates. The absorption oftritiated thymidine in the individual 200 .mu.l wells was measured after adding 1 .mu.Ci of thymidine for the last 18 hours of culture. The results were expressed in the form of the mean of 3 tests. The standard deviation was usually less than 12% (alittle more in the case of very low cpm measurements). Moreover, mixed culture (clone 154/APC) supernatants were combined, filtered through 0.22 .mu.m membranes, divided into samples and frozen at -20.degree. C. until the time of titration usingcommercial immunoassay kits: Immunotech IL-2 and INF-.alpha. titration kit, Genzyme IFN-.gamma. kit and Cayman Chemicals IL-4 kit.

A dose determination study was carried out to establish the proliferation profiles of clone 154 brought into contact with the p20 specific antigen at varying concentrations and in the presence or absence of anti-LAG-3 monoclonal antibodies orirrelevant monoclonal antibodies (negative control).

The individual results of 16 separate tests showed that, irrespective of the concentration of added antigen, the initial point up to the peak of proliferation was not modified, but a significant prolongation of the proliferation of T lymphocytesincubated with the anti-LAG-3 monoclonal antibodies was observed systematically. Fab fragments of the monoclonal antibody 17B4 were prepared and used in a test of proliferation of clone 154. The proliferation profile of T lymphocytes activated by theantigen with the 17B4 Fab fragments (15 .mu.g/ml) was similar to that of cells incubated in the presence of whole 17B4 monoclonal antibody (40 .mu.g/ml) (FIG. 1). These results show that the observed biological effects are not attributable to anon-specific reaction induced by the Fc region of the anti-LAG-3 monoclonal antibodies.

Similar results were obtained with the 11E3 anti-LAG-3 monoclonal antibodies.

Clone 28 was also stimulated with the antigen (tetanus toxoid 10 .mu.g/ml) in the presence of 17B4 monoclonal antibodies after coculture with the corresponding APC in the presence of DT. The results are shown in FIG. 2.

The effects of the anti-LAG-3 monoclonal antibodies observed with clone 28, namely the prolongation of proliferation, are similar to those observed with clone 154.

Tests were carried out designed to measure the miscellaneous cellular events occurring after the antigenic stimulation of clone 154 cells incubated in the presence of anti-LAG-3 monoclonal antibodies.

The cells were harvested during conventional antigenic stimulation of clone 154 in the presence of anti-LAG-3 or anti-CD48 monoclonal antibodies or in the absence of antibodies, and tested for the expression of LAG-3 and CD25 transmembranereceptors, and samples of culture supernatants were collected at different time intervals after stimulation and tested for the presence of IFN-.gamma., TNF-.alpha., IL-4 and IL-2.

Two-colour direct immunofluorescence tests (anti-CD3 monoclonal antibodies and anti-CD25 monoclonal antibodies) showed that IL-2 receptors were weakly but significantly increased 5 days after the antigenic stimulation. Similar tests withanti-CD3 and 11E3 (anti-LAG-3) monoclonal antibodies showed that LAG-3 was over-expressed from the day following activation onwards. In addition, the secretion of IL-2, IL-4, IFN-.gamma. and TNF-.alpha. was also modulated by incubation with anti-LAG-3monoclonal antibodies, thus showing that different cellular events are modified by the presence of anti-LAG-3 monoclonal antibodies and that some events already take place 24 hours after stimulation.

These results show indirectly that LAG-3 plays a regulatory role for CD4.sup.+ cells. The fact that anti-LAG-3 monoclonal antibodies increase proliferation, and hence act as immunopotentiators, suggest that LAG-3 is involved in the"deactivation" of CD4.sup.+ T lymphocytes with a negative role of LAG-3 on the antigen-dependent stimulation.

EXAMPLE 2

Transient expression of LAG-3 fusion proteins

Soluble proteins derived from LAG-3 were obtained by a recombinant DNA technique using suitable vectors comprising DNA coding for LAG-3 and DNA coding for an immunoglobulin fragment. The transient expression system consisted of transfected Coscells. This system makes it possible to produce several mg of recombinant fusion proteins. Recombinant DNA techniques were carried out as described by MANIATIS et al. (22). The modifications were made as recommended by the manufacturer.

Construction of LAG-3 D1-D4 Ig and LAG-3 D1D2 Ig

Fragments coding for the D1D2 or D1-D4 regions were amplified (30 cycles) from a fragment of cDNA (FDC sequence) encompassing LAG-3 cDNA (TRIEBEL et al. (1)), using Taq polymerase free from 5'-endonuclease activity and relatively resistant to anexposure to very high temperature; the amplification was followed by a denaturation at 98.degree. C. (with a Perkin Elmer Cetus "DNA thermal cycle"). Specific primers were used as recorded in the table below.

The resulting amplified fragments (739 bp and 1312 bp for LAG-3 D1-D2 and LAG-3 D1-D4, respectively) were inserted into a pBS plasmid (Stratagene).

Inserts were prepared after digestion with XhoI and BglII and introduced into the XhoI/BamHI sites of the vector pCDM7-CD8-IgG1 (pCDM7 being derived from pCDM8 marketed by Stratagene), as illustrated in FIG. 3, so as to exchange the DNA sequencescoding for CD8 for those coding for the subfragments of LAG-3. The resulting expression vectors contained the sequences coding for D1D2 or D1-D4 fused to the DNA sequences coding for the --CH.sub.2 --CH.sub.3 junction region of a human IgG1 chain.

TABLE 3 Primers used to amplify LAG-3 DNA sequences by PCR Resulting encoded subfrag- ment fused with Primers used for amplification of the DNA a subfragment Ig Primer (5') LAG-3 D1D2 5' GCGCCTCGAGGCCCAGACCATAGGAGAGATGT 3' (SEQ ID NO:2) from the leader coupling untranslated start of sequence to site 5' sequences translation amino acid.[.241.]. 239 Primer (3') 5' GCGCAGATCTCTCCAGACCCAGAACAGTGAGGTTATACAT 3' (SEQ ID NO: 3) BglII coup- End of D2 ling site Primer (5') LAG-3D1-D4 identical to LAG-3 D1D2 from the leader Primer (3') sequence to 5' GCGCAGATCTACCTGGGCTAGACAGCTCTGTGAA 3' (SEQ ID NO: 4) amino acid 412 BglII coup- End of D4 ling site

CDM7 is a eukaryotic expression vector derived from the vectors developed by SEED et al. (10) for the cloning of DNA and its expression in E. coli and eukaryotic cells. CDM7 possesses the following features: (i) the human cytomegaloviruspromoter for transient expression in mammalian cells; (ii) a viral origin of SV40 for an autosomal replication of mammalian cells expressing T antigen; (iii) .pi.VX (type Col E1) as plasmid origin for a high copy number; (iv) a Sup F selection forresistance to ampicillin and tetracycline in Tet.sup.amb and Amp.sup.amb E. coli strains; (v) an origin of replication of M13 for the release of a single strand; (vi) a T7 RNA promoter; and (vii) a polylinker for an efficient cloning of heterologous DNA.

Transient expression in COS cells

Cos cells (5.times.10.sup.6) were transfected with 30 .mu.g of DNA of suitable expression vectors (coding for either LAG-3 D1D2 Ig, or LAG-3 D1-D4 Ig, or CD8 Ig) by electroporation (200 V, 1500 .mu.F, 30-40 msec) using a Cellject apparatus(Eurogentech, Liege, BE). The cells were plated out again and cultured on a medium containing 5% of foetal calf serum. The supernatants were withdrawn 6 days after transfection.

The synthesis of the resulting fusion proteins was analysed from the supernatants as well as from cell extracts of transfected cells, by Western blot analysis with the 17B4 monoclonal antibodies. Immunoreactive materials were observed in thesupernatant of cells transfected with DNA coding for LAG-3 D1D2 Ig or LAG-3 D1-D4 Ig.

Concomitantly, a recombinant CD8 immunoadhesin (CD8 Ig) was obtained as negative control using the same expression system and the expression vector pCDM7-CD8 (FIG. 3).

The recombinant proteins LAG-3 D1D2 Ig. LAG-3 D1-D4 Ig and CD8 Ig were purified by means of the standard method on protein A-Sepharose. The resulting material was analysed by SDS-PAGE, followed by Coomassie staining or a Western blot analysisusing anti-human Ig antibody.

EXAMPLE 3

Production of soluble subfragments of LAG-3

In order to produce large amounts of recombinant proteins, a stable expression system consisting of transfected mammalian cells was developed. The host cells are anchorage-dependent hamster ovary (CHO) cells isolated from CHO cells deficient indihydrofolate reductase (DHFR) and consequently necessitating glycine, a purine and thymidine for their growth. The pivotal role of DHFR in the synthesis of nucleic acid precursors, combined with the sensitivity of DHFR-deficient cells with respect totetrahydrofolate analogues such as methotrexate (MTX), has two major advantages. Transfection of these cells with expression vectors containing the DHFR gene permits the secretion of recombinant DHFR-resistant clones, and the culturing of these cells onselective media containing increasing amounts of MTX results in amplification of the DHFR gene and the DNA associated therewith.

Construction of LAG-3 D1, LAG-3 D1D2, LAG-3 D1-D4

Fragments of DNA coding for the D1, D1D2 or D1-D4 regions were amplified using a PCR method identical to the one described previously, using the primers specified in the table below.

TABLE 4 Primers used for amplifying LAG-3 DNA sequences by PCR Resulting encoded Primers used for amplification of the DNA subfragment Primer (5') LAG-3 D1 5' CGCCGTCGACCGCTGCCCAGACCATAGGAGAGATGTG 3' (SEQ ID NO:5) from the leader SalIcoup- untranslated start of sequence to ling site 5' sequences translation amino acid .[.149.]. .Iadd.159.Iaddend. Primer (3') 5' GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 6) SalI coup- End of D1 ling site Primer (5') LAG-3 D1D2 identical to LAG-3 D1 from the leader Primer (3') sequence to 5' GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 7) amino acid 239 SalI[II] coup- End of D2 ling site .[.Primer (3').]. .[.amino acid 149.]. 5'GCGCGTCGACTTAACCCAGAACAGTGAGGTTATAC 3' (SEQ ID NO: 6) SalI coup- End of D1 .[. ling site.]. Primer (5') LAG-3 D1-D4 identical to LAG-3 D1 from the leader Primer (3') sequence to 5' GCGCGTCGACTTAACCCTGGGCTAGACAGCTCTCTGTG 3' (SEQ ID NO:8) amino acid 412 SalI coup- End of D4 ling site

The resulting amplified fragments were digested with SalI and inserted into the SalI site of pUC 18 (Stratagene).

The amplified sequences were verified, and the inserts subcloned into the expression vector pCLH3 AXS V2 DHFR h.alpha. IVS as described by COLE et al. (Biotechnology 11, 1014-1024, 1993) (FIG. 4).

This vector is a eukaryotic expression vector which is multifunctional for the expression .[.C.]. .Iadd.c.Iaddend.DNA and its amplification in eukaryotic cells. It possesses the following features: (i) the murine promoter of themetallothionein-1 gene and a polyadenylation sequence SV 40 (comprising a donor-acceptor splicing site) to bring about transcription of the gene of interest, (ii) a human intervening sequence A containing the donor-acceptor splicing site of the gene forthe subunit of .alpha. glycoprotein for obtaining high levels of transcription of cDNA, (iii) the pML sequence containing the origin of replication of pBR322 and a gene for resistance to .[.aampicillin.]. .Iadd.ampicillin .Iaddend.for bacterialamplification, and (iv) a DHFR transcription unit of SV 40 to bring about transcription of the sequences used for selection and amplification of the transfectants.

Stable expression in CHO cells

The expression vectors coding for LAG-3 D1, LAG-3 D1D2 and LAG-3 D1-D4 were used to transfect CHO DUKX cells, and these cells were cultured on a selective medium. Cells capable of multiplying under these conditions were combined and cultured ona medium containing increasing amounts of MTX. Levels of expression were measured by Western blot analysis using the 17B4 monoclonal antibody. Clones producing high levels of recombinant soluble molecules derived from LAG-3 were propagated inbioreactors, and the material derived from LAG-3 was purified by ion exchange chromatography and immunoaffinity.

Western blot analyses revealed, in supernatants of cells transfected with expression vectors coding for LAG-3 D1, LAG-3 D1D2 and LAG-3 D1-D4, bands with apparent Mr values of 15 to 18 kD, 34-36 kD (doublets) and 55 kD (2 possible bands). Therespective Mr values of these immunoreactive materials corresponded to the expected Mr values of glycosylated LAG-3 D1 Ig (139 amino acids and a putative N-glycosylation site), glycosylated LAG-3 D1D2 Ig (239 amino acids containing 3 glycosylation sites)and glycosylated LAG-3 D1-D4 (412 amino acids containing 4 glycosylation sites).

EXAMPLE 4

Specific binding of LAG-3 Ig to cells expressing MHC Class II

The reactivity of the monoclonal antibodies and of LAG-3 D1-D4 Ig was studied by indirect immunofluorescence. Target cells (4.times.10.sup.5) were incubated for 30 minutes at 4.degree. C. in the presence of LAG-3 D1-D4 Ig, CD8 Ig, a murinemonoclonal antibody, (949) anti-human MHC Class II (DR, DP, DQ) conjugated to FITC (isothiocyanate fluoride) from a Coulter clone, or murine Ig-FITC; an irrelevant immunoglobulin G conjugated to FITC. The cells were washed and incubated at 4.degree. C.for 30 minutes with either a goat anti-human Ig polyclonal F(ab').sub.2 conjugated to fluorescein or a goat anti-mouse Ig polyclonal antibody conjugated to fluorescein (Coulter clone).

To confirm the LAG-3/MHC Class II binding, LAG-3 D1-D4 Ig was incubated with MHC Class II-positive or -negative cells. Four B lymphocyte lines expressing MHC Class II(L31, Phil EBV, Raji, Sanchez and Personnaz) were treated with anti-Class IImonoclonal antibody 949, or the supernatants for Cos cells transfected with DNA coding either for LAG-3 D1-D4 Ig or for CD8 Ig. The five cell lines expressing the different haplotypes of MHC Class II molecules were recognized by LAG-3 Ig in the same wayas by the anti-Class II monoclonal antibodies (positive control), while the supernatant containing CD8 Ig (negative control) did not bind to these cell lines, as could be expected. Four MHC Class II-negative cell lines (CEM, RJ, HSB2, K562) were treatedwith the same reagents as above. None reacted, either with the anti-MHC Class II (negative control) or with LAG-3 D1-D4 Ig, showing that the binding of LAG-3 D1-D4 is specific to MHC Class II molecules.

Further experiments were carried out using (i) mouse fibroblasts transfected or otherwise with genes coding for human DR7 or human DP4, (ii) mouse cells expressing or otherwise MHC Class II molecules, (iii) activated human CD4.sup.+ or CD8.sup.+cells, and (iv) T lymphocyte lines expressing the different haplotypes of MHC Class II molecules (FIG. 8).

Unlike CD8 Ig, LAG-3 D1-D4 Ig binds to all cells expressing MHC Class II as efficiently as the anti-MHC Class II monoclonal antibody 949. LAG-3 D1-D4 Ig binds to all DR and DP haplotypes tested, to human MHC Class II molecules expressed bytransfected mouse cells, to murine MHC Class II molecules and also to MHC Class II molecules expressed by CD4.sup.+ or CD8.sup.+ T lymphocytes.

These results represent for the first time proof that soluble molecules derived from a ligand for MHC Class II are capable of binding to cells expressing MHC Class II.

Similar experiments showed that LAG-3 D1D2 bound to cells expressing MHC Class II in as specific a manner and with the same efficiency as LAG-3 D1-D4.

Binding activity of LAG-3Ig and cellular distribution of ligands for LAG-3Ig

The capacity of this immunoadhesin to bind to cell ligands is measured using a fluorescein-labeled goat serum directed against human immunoglobulins.

In these experiments, the target cells are first incubated with a human monoclonal antibody or an immunoadhesin for 30 min at 4.degree. C. in RPMI 1640 containing 10% of FCS (foetal calf serum). The cells are then incubated with anFITC-labelled goat anti-mouse immunoglobulin serum (Coulter) for the murine monoclonal antibodies or with an FITC-labelled goat anti-human immunoglobulin serum (Tago) for the immunoadhesins. The fluorescence is measured after two washes, analyzing 3,000cells with an Elite cytometer (Coultronics, Hialeah, Fla.). FIG. 9 shows the degrees of binding of LAG-3Ig, CD8Ig, antibody 949 or antibody OKT3 (anti-CD3, ATCC), represented by the number of cells counted as a function of the logarithm of the measuredfluorescence intensity.

LAG-3Ig binds to mouse fibroblasts transfected for the gene for the HLA DR.sub.4 molecule, and does not bind to untransfected cells. CD8Ig is incapable of binding to HLA DR.sub.4.sup.+ fibroblasts under the same conditions.

The cellular distribution of the ligands for LAG-3Ig was evaluated on a cell population sample by immunofluorescence.

LAG-3Ig is visualized on all positive Class II cells tested, including B cell lines transformed by Epstein-Barr virus (derived from genetically unrelated donors, including 10 homozygous lines of DR.sub.1 to DR.sub.10 typing), as well as onactivated T and NK cells.

FIG. 9 shows, by way of example, the binding of LAG-3Ig to Daudi cells which are positive for Class II antigens.

The mean fluorescence intensity with LAG-3Ig is similar to that observed with antibody 949 which is specific for Class II antigens. The binding of LAG-3Ig to DR.sub.4 (FIG. 9). DR.sub.2, DR.sub.7 or DPw4 (not shown) expressed at the surface ofmouse fibroblasts is, in contrast, weaker than that observed for antibody 949.

No binding is detected on cell lines which are negative for Class II antigens of T origin (peripheral blood T cells, CEM, HSB2, REX lines), of B origin (RJ 2.2.5 line) or of non-lymphoid origin (human lines, K562 of erythromyoloid origin and lineoriginating from melanoma cells (not shown)).

Moreover, LAG-3Ig binds to xenogeneic Class II molecules of the MHC, such as the antigens expressed by mouse lymphoid A 20 and the monkey Classes II expressed by phytohaemagglutinin-stimulated blasts (data not shown).

The specificity of binding of LAG-3Ig was also verified using the monoclonal antibodies 17B4, whose capacity to block LAG-3/MHC Class II interactions in cell adhesion tests was demonstrated beforehand (FIG. 10).

In these experiments, the LAG-3Ig molecules are preincubated for 30 minutes at 4.degree. C. either with medium alone, or with 17B4 (1 mg/ml), or with OKT3 (1 mg/ml), before being brought into contact with Daudi cells.

FIG. 10 shows that a preincubation of LAG-3Ig with 17B4 inhibits the binding to Class II.sup.+ cells, whereas no inhibition is detected with the OKT3 control.

EXAMPLE 5

Inhibition of LAG-3/MHC Class II interaction by soluble fragments of LAG-3

The inhibition of LAG-3/MHC Class II interaction by the soluble fragments of LAG-3 may be observed directly in relation to the binding of LAG-3Ig by Class II MHC molecules, by competitive experiments with the soluble fragments.

To verify whether the soluble LAG-3D.sub.1 D.sub.2 fragments produced by CHO cells could displace the binding of immunoadhesins derived from LAG-3, the following tests were carried out:

Daudi cells are incubated with soluble LAG3-D.sub.1 D.sub.2 fragments so as to permit the binding of these molecules to the MHC Class II antigens expressed at the surface of the Daudi cells.

In a second step, the cells are incubated in the presence of LAG-3D.sub.1 D.sub.4 Ig in dimeric form or LAG-3D.sub.1 D.sub.2 Ig in monomeric form.

The binding of these immunoadhesins derived from LAG-3 is measured using a goat anti-human Ig F(ab').sub.2 conjugated to fluorescein (GAH-FITC).

The control groups are represented by Daudi cells incubated with dimeric LAG-3D.sub.1 D.sub.4 Ig or monomeric LAG-3D.sub.1 D.sub.2 Ig without preincubation with the soluble LAG-3D1D2 fragments.

The results are recorded in Table 5, which shows that the soluble LAG-3D.sub.1 D.sub.2 fragments are capable of displacing the immunoadhesins derived from LAG-3 in .[.monoor.]. .Iadd.mono or .Iaddend.dimeric form.

TABLE 5 Mean Fluor- Reactants Detection escence Conclusion -- GAH-FITC 0.3 GAH does not interfere Dimeric GAH-FITC 20.8 The binding of LAG-3D1D4Ig CHO/LAG-3D1D2 inhibits the binding CHO/LAG-3D1D2, GAH-FITC 8.5 of dimeric then dimericLAG-3D1D4Ig (58%) LAG-3D1D4Ig Monomeric GAH-FITC 62.5 The binding of LAG-3D1D2Ig CHO/LAG-3D1D2 inhibits the binding CHO/LAG-3D1D2 GAH-FITC 10.9 of monomeric then monomeric LAG-3D1D2Ig (27%) LAG-3D1D2Ig

These data confirm that the soluble LAG-3D1D2 fragments bind to MHC Class II molecules.

Inhibition of LAG-3/MHC Class II and CD4/MHC Class II interaction

Rosette formation between Cos cells transfected with wild-type LAG-3 and B lymphocytes transformed with EBV expressing MHC Class II molecules was demonstrated by BAIXERAS et al. (2). This interaction is inhibited both by anti-LAG-3 and anti-MHCClass II monoclonal antibodies.

The method described in this publication was modified by replacing the visualization and counting of Cos cells binding to B lymphocytes by counting the radioactivity remaining after incubation of .sup.51 Cr-labelled B lymphocytes with Cos cellsexpressing LAG-3 (binding assay).

The possible inhibitory effects of soluble molecules derived from LAG-3 on LAG-3/MHC Class II interaction, and also on CD4/MHC Class II interaction, were studied.

Cos cells transfected with a suitable expression vector (coding for wild-type LAG-3 or for CD4). Two days later, the Cos cells were treated with trypsin and plated out again on the basis of 0.05.times.106 cells/well on a flat-bottomed 12-welltissue culture plates, 24 hours later. .sup.51 Cr-labelled Daudi cells (5.5.times.10.sup.6) were incubated on this monolayer of Cos cells (final vol.: 1 ml) for 1 hour. The target B cells were then aspirated off and the wells washed 5 to 7 times,gently adding 1 ml of medium dropwise. The edges of the wells were washed by suction using a Pasteur pipette. The remaining cells were lysed with 1 ml of PBS, 1% Triton for 15 minutes at 37.degree. C. The lysates were centrifuged at 3000 rpm for 10minutes, and 100 .mu.l of the resulting supernatant were counted.

LAG-3 D1-D4 Ig was used to inhibit LAG-3/MHC Class II and CD4/MHC Class II interaction in the .sup.51 Cr binding assay. Human CD8 Ig and IgG1 were tested in parallel and used as negative controls.

A significant inhibition of LAG-3/Class II interaction by LAG-3 D1-D4 Ig was detected (FIG. 5A). However, the LAG-3/MHC Class II interaction can be partially and non-specifically inhibited by human CD8 Ig and IgG1. Moreover, LAG-3 Ig proved tobe a potential inhibitor of CD4/Class II interaction (FIG. 5B) under experimental conditions in which CD4/MHC Class II interaction was not modified by human CD8 Ig or IgG1. This suggests that LAG-3/Class II interaction is weaker than CD4/Class IIinteraction. These results represent the first proof of a possible competition of soluble molecules in an interaction of MHC Class II with its ligands.

EXAMPLE 6

Immunosuppressant activity of LAG-3 D1-D4 Ig

Functional tests were performed using the proliferation tests described above for the biological activity of the anti-LAG-3 monoclonal antibodies.

3 days and 5 days (D3 and D5) after antigenic stimulation, LAG-3 D1-D4 Ig showed a strong inhibition of the proliferation of clone 28, while human CD8 Ig and IgG had no effect (FIG. 6). Similar experiments were carried out with clone 154 (FIG.7), and showed a partial inhibition in the presence of LAG-3 Ig. A control carried out with anti-LAG-3 monoclonal antibodies had the reverse effects, as observed previously.

A significant inhibition of the cell proliferation of cells incubated in the presence of LAG-3 D1-D4 Ig was also observed for clone 28.

These observations show that LAG-3 D1-D4 Ig is a potential immunosuppressant of the proliferation of T lymphocytes stimulated by an antigen, and indicate that LAG-3 might act as an "extinguisher" of the secondary immune response induced byactivated CD4.sup.+ T helper lymphocytes.

Role of LAG-3Ig in the negative regulation of the immune responses of T cells

To demonstrate that a soluble form of LAG-3, mimicking the functions of the membrane molecule, could inhibit the activation of CD.sub.4.sup.+ T clones stimulated by an antigen, the following tests were carried out on clone T154: the T cells areincubated beforehand with a saturating amount of LAG-3Ig (100 nM). The cells are then washed twice with cold RPMI and incubated with 10 .mu.g/ml of goat antibodies directed against human immunoglobulins (Tago) at 4.degree. C. for 30 minutes.

After two more washes, the cells are resuspended in RPMI containing 10% of foetal calf serum and incubated for 2 hours at 37.degree. C. before adding the signal. To couple ("cross-link") the monoclonal antibodies, a goat anti-mouse antibody ata concentration of 10 .mu.g/ml (Tago) is used.

FIG. 11 depicts an experiment in which clone T154 has been preincubated with LAG-3Ig bound ("cross-linked") to a second reactant (polyclonal serum specific for the constant region of human immunoglobulins). The degree of binding of LAG-3Ig tothe cells is measured by immunofluorescence (FIG. 11A). FIG. 11B shows that a more than 50% inhibition of the proliferation of clone T154 is produced by LAG-3Ig. Under the same experimental conditions, no effect is observed with the control CD8Ig orwith LAG-3Ig without "cross-linking" (not shown in the figure).

FIG. 11C also shows that no effect is observed when LAG-3Ig is used to bind ("cross-link") the MHC Class II molecules expressed by antigen-presenting B cells.

The possible effects of bound ("cross-linked") anti-Class II monoclonal antibodies in relate to the proliferation of T cells were compared to those of LAG-3Ig. A weak inhibition (less than 50%) is observed with antibody 949 and antibody D1.12(anti-DR) bound to a goat anti-mouse polyclonal serum (FIG. 12). The inhibition of proliferation is hence epitope-dependent, the largest effect being obtained with the epitope of LAG-3 specific for the binding to .[.Classes.]. .Iadd.Class .Iaddend.II.

The effects of LAG-3 Ig on the proliferation of T cells were also studied using different signals on another CD.sub.4.sup.+ T clone, clone TDEL specific for peptide 34-53 of the basic myelin protein.

An inhibition of proliferation is observed (n=2) when TDEL is stimulated with the antigen (not shown), with immobilized OKT3 (FIG. 13A), with lectins (PHA+PMA) (FIG. 13B) and with 5 IU/ml of IL.sub.2 (FIG. 13C). No inhibition is observed with100 IU/ml of IL.sub.2 (FIG. 13D).

In conclusion, these results collectively show that LAG-3 and MHC Class II molecules, which are each T cell-activating antigens, may be likened to effector molecules involved in the phase of inactivation of T cell responses. Moreover, theseresults illustrate the importance of interactions between T cells in the control of the cellular immune response.

EXAMPLE 7

Stimulation of cell cytotoxicity by LAG-3Ig

The role of LAG-3Ig in relation to cell cytotoxicity is studied on two types of effector cells: freshly drawn human peripheral blood lymphocytes (PBL), S1B5 line cells (clone of human NK cells).

The cytotoxic activity of these cells is measured by counting the .sup.51 Cr released into the medium by previously labelled target cells, in the presence or absence of LAG-3Ig in the medium.

FIG. 14 shows the degree of cytotoxicity of S1B5 for a line of human B cells transformed by Epstein-Barr virus and carrying major histocompatibility complex Class I and II antigens (LAZ 388 line), as a function of different reactants added to thecultures.

Measurements are carried out after 4 hours of coculture for effector/target (S1B5/LAZ 388) cell ratios of 3:1 (clear columns) or 1:1 (shaded columns).

The negative controls consist of medium alone (MED), the immunoadhesin CD8Ig and the monoclonal antibody 17.B4 (anti-LAG-3).

The positive controls consist of three different monoclonal antibodies: antibody L243 directed against Class II DR antigens, antibody 9.49 directed against Class II DR, DP, DQ antigens, antibody W632 directed against human majorhistocompatibility complex Class I antigens.

Anti-HLA Class I (W632) or Class II (L243) antibodies increase the lysis of the target cells (and not the 17B4 control). The immunoadhesin LAG-3Ig increases the lysis. The CD8Ig control has no effect.

FIG. 15 shows the results of an experiment similar to the above, in which the cytotoxicity of PBL with respect to Daudi cells (HLA Class I.sup.-) is measured, for effector/target ratios of 50:1 (clear columns) and 15:1 (shaded columns). Thereactants added to the medium are the same as the ones used in the first experiment, except for antibody 9.49 and antibody 17.B4. Antibody 10H3 is an isotype IgG1 immunoglobulin specific for the CD45 surface antigen. It is used as negative control.

No change is observed with an antibody directed against major histocompatibility complex Class I antigens (W632).

The data from these two series of measurements shown that, compared to negative controls, LAG-3Ig activates the cytotoxicity of NK cells. This effect is similar to the one observed with antibodies directed against MHC Class II molecules.

BIBLIOGRAPHIC REFERENCES 1. TRIEBEL T. et al., 1990, J. Exp. Med. 171, 1393-1405 2. BAIXERAS E. et al., 1992, J. Exp. Med. 176, 327-337 3. COSGROVE D. et al., 1991, Cell 66, 1051-1066 4. RAHEMTULLA A. et al., 1991, Nature 353, 180-184 5. TRAUNECKER A. et al., 1988, Nature 351, 84-86 6. BENEDICT A. A. et al., 1967, Methods in Immunology 1, 197-306 (1967) 7. YELTON D. E. et al., Ann. Rev. of Biochem. 50, 657-680 (1981) 8. HUARD B. et al., Immunogenetics 39: 213 9. MANIATIS T. et al.(1982), Molecular cloning: A laboratory manual--Cold Spring Harbor Laboratory, New-York. 10. SEED B., 1987, Nature 329, 840-842 11. COLE S. C. et al., Biotechnology 11, 1014-1024, 1993 12. COLE S. C. et al., Biotechnology 11, 1014-1024, 1993.

TABLE NO. 1 residue atom type, Atom name and charge and name x y z no. no. N 25.172370911 27.259836197 67.855064392 AP-n 40 n3 -0.5000 1 NN2 25.667764664 26.471963882 67.420585632 AP-n 40 hn 0.1300 2 CA 24.625223160 26.86749458369.180244446 AP-n 40 ca 0.1200 3 NN1 24.393711090 27.474891663 67.220008850 AP-n 42 hn 0.1300 4 MA 23.936895370 27.680395126 69.464080811 AP-n 40 h 0.0700 5 C 25.662780726 26.773513794 70.350120544 AP-n 40 c' 0.3800 6 O 25.295415878 27.09074783371.482070923 AP-n 40 o' -0.4100 7 CB 23.766021729 25.587018967 68.990669250 AP-n 40 c2 -0.2600 8 MB1 23.060285568 25.72443695 68.152351379 AP-n 40 h 0.0700 9 MB2 24.413969040 24.744903564 68.686981201 AP-n 40 h 0.0700 10 CG 22.92177581825.153419495 70.196960449 AP-n 40 c- 0.3400 11 DD1 22.069602966 25.929233551 70.676017761 AP-n 40 o- -0.5700 12 DD2 23.115716934 24.009321213 70.667663574 AP-n 40 o- -0.5700 13 M 26.906179428 26.304588318 70.124969482 SER 41 n -0.5000 14 CA27.860145569 25.912786484 71.207519531 SER 41 ca 0.1200 15 HN 27.120641708 26.221813202 69.126319885 SER 41 hn 0.2800 16 MA 27.374551773 25.088045120 71.766326904 SER 41 h 0.1000 17 C 28.252065659 27.005065918 72.271789551 SER 41 c' -0.3800 18 O27.987834930 28.200620651 72.115295410 SER 41 o' -0.3800 19 CB 29.083601227 25.298025131 70.494880676 SER 41 c2 -0.1700 20 MB1 28.786190033 24.599395752 69.690521240 SER 41 h 0.1000 21 MB2 29.691858292 26.092912674 70.004081726 SER 41 h 0.1000 22 OG 29.905221939 24.578149796 71.424118042 SER 41 oh -0.3800 23 HG 30.662555695 24.231645584 70.939277649 SER 41 ho 0.3500 24 N 28.857526779 26.558052063 73.387054443 GLY 42 n -0.5000 25 CA 29.199718475 27.440891266 74.535232544 GLY 42 cg 0.0200 26 MN 29.251720428 25.616510391 73.267890930 GLY 42 hn 0.2800 27 MA1 28.520187378 28.312047958 74.591857910 GLY 42 h 0.1000 28 MA2 28.983697891 26.890144348 75.468444824 GLY 42 h 0.1000 29 C 30.691051483 27.875793457 74.601707458 GLY 42 c' 0.3800 30 O 31.504199982 27.026502609 74.980445862 GLY 42 o' -0.3800 31 N 31.113182068 29.132183075 74.266487122 PRO 43 n -0.4200 32 CA 32.858349609 29.476200104 74.126792908 PRO 43 ca 0.0600 33 HA 33.096603394 28.605407715 73.708091736 PRO 43 h 0.1000 34 CD 30.24075089 30.174203873 73.722633362 PRO 43 c2 0.0600 35 MD1 29.467987061 30.516298294 74.466743469 PRO 43 h 0.1000 36 MD2 29.664882660 29.799777985 72.838768005 PRO 43 h 0.1000 37 C 33.318023682 29.988374710 75.414916992 PRO 43 c' 0.3800 38 O 32.682361603 30.557033539 76.312332153 PRO 43 o' -0.3800 39 CB 32.483139038 30.574260712 73.043136597 PRO 43 c2 -0.2000 40 MB1 33.350620270 31.263189316 73.049049377 PRO 43 h 0.1000 41 MB2 32.463790894 30.110534668 72.036743164 PRO 43 h 0.100042 CG 31.160949707 31.299722672 73.307487488 PRO 43 c2 -0.2000 43 MG1 31.279897690 32.024162292 74.137779236 PRO 43 h 0.1000 44 MG2 30.794561386 31.862808228 72.428352356 PRO 43 h 0.1000 45 K 34.683673859 29.902477264 75.503486633 PRO 44 n -0.4200 46 CA 35.485736847 30.679145813 76.490524292 PRO 44 ca 0.0600 47 KA 35.018527985 30.645456314 77.491592407 PRO 44 h 0.1000 48 CD 35.509281158 29.014368057 74.655700684 PRO 44 c2 0.0600 49 MD1 35.411357880 29.247959137 73.577461243 PRO 44 h 0.1000 50 MD2 35.214973450 27.955932617 74.801994324 PRO 44 h 0.1000 51 C 35.700843811 32.172924042 76.063224792 PRO 44 c' 0.3800 52 O 36.448230743 32.477428436 75.126922607 PRO 44 o' -0.3800 53 CB 36.779544830 29.842718124 76.547348022 PRO 44 c2 -0.2000 54 HB1 37.662769315 30.430650711 75.863670149 PRO 44 h 0.1000 55 HB2 36.667564392 29.027103424 77.288825989 PRO 44 h 0.1000 56 CG 36.940769196 29.250995636 75.143180867 PRO 44 c2 -0.2000 57 MG1 37.446662903 29.982709885 74.483322144 PRO 44h 0.1000 58 MG2 37.553295135 26.329860667 75.134750366 PRO 44 h 0.1000 59 N 35.026676178 33.104183197 76.753837585 ALA 45 h -0.5000 60 CA 35.034278870 34.544979095 76.400695801 ALA 45 ca 0.1200 61 MN 34.452354431 32.747509003 77.536170959 ALA 45hn 0.2800 62 MA 35.105010986 34.659946442 75.298950195 ALA 45 h 0.1000 63 C 36.209384918 35.322113037 77.076705833 ALA 45 c' 0.3800 64 O 36.163528442 35.637268066 78.268325806 ALA 45 o' -0.3800 65 CB 33.646369934 35.083190918 76.800727844 ALA 45c3 -0.3000 66 MB1 33.534698486 36.150661469 76.535202026 ALA 45 h 0.1000 67 MB2 32.828392029 34.539138794 76.290328979 ALA 45 h 0.1000 68 MB3 33.465579987 35.001335144 77.890525818 ALA 45 h 0.1000 69 N 37.266757965 35.613758087 76.297294617 ALA46 n -0.5000 70 MN 37.216701508 35.231555939 75.346885681 ALA 46 hn 0.2800 71 CA 38.489383698 36.310386658 76.786270142 ALA 46 ca 0.1200 72 MA 38.262126923 36.871456146 77.716934204 ALA 46 h 0.1000 73 C 39.058414459 37.311935425 75.727844238 ALA46 c' 0.3800 74 O 38.922710419 37.100418091 74.516731262 ALA 46 o' -0.3800 75 CB 39.526046753 35.215301514 77.108406067 ALA 46 c3 -0.3000 76 MB1 40.446556091 35.633434296 77.555480957 ALA 46 h 0.1000 77 MB2 39.131206512 34.469978333 77.822120667ALA 46 h 0.1000 78 MB3 39.821903229 34.663463593 76.197715759 ALA 46 h 0.1000 79 N 39.737388611 38.384365082 76.180320740 ALA 47 n -0.5000 80 CA 40.295833588 39.429889679 75.275863647 ALA 47 ca 0.1200 81 MN 39.717037201 38.512592316 77.196357727ALA 47 hn 0.2800 82 MA 39.901103973 39.219335938 74.245994568 ALA 47 h 0.1000 83 C 41.869789124 39.413467407 75.170806885 ALA 47 c' 0.3800 84 O 42.518333435 40.166862488 75.906578044 ALA 47 o' -0.3800 85 CB 39.722030640 40.769996643 75.786285400ALA 47 c3 -0.3000 86 MB1 40.045078278 41.611721039 75.145561218 ALA 47 h 0.1000 87 MB2 38.615306854 40.778987885 75.787467957 ALA 47 h 0.1000 88 MB3 40.059757233 41.007873535 76.813346863 ALA 47 h 0.1000 89 N 42.537422180 38.62159729074.274406433 PRO 48 n -0.4200 90 CA 44.009857178 38.718185425 74.045745850 PRO 48 ca 0.0600 91 MA 44.539390564 38.855972290 75.008773804 PRO 48 h 0.1000 92 CD 41.903011322 37.522361755 73.516281128 PRO 48 c2 0.0600 93 MD1 41.08117675837.871139526 72.860626221 PRO 48 h 0.1000 94 MD2 41.490711312 36.761222839 74.206848145 PRO 48 h 0.1000 95 C 44.448683322 39.844142914 73.044319153 PRO 48 c' 0.3800 96 O 43.693031311 40.225761414 72.144134521 PRO 48 o' -0.3800 97 CB 44.30290277137.304885864 73.500595093 PRO 48 c2 -0.2000 98 MB1 45.227554321 37.245840894 72.897834778 PRO 48 h 0.1000 99 MB2 44.442562103 36.597515106 74.341529846 PRO 48 h 0.1000 100 CG 43.051033020 36.925685883 72.702011108 PRO 48 c2 -0.2000 101 MG143.084365845 37.389282227 71.696128845 PRO 48 h 0.1000 102 MG2 42.948661804 35.835418701 72.555740356 PRO 48 h 0.1000 103 N 45.700798035 40.324272156 73.165817261 GLY 49 n -0.5000 104 CA 46.289730072 41.291931152 72.184875488 GLY 49 cg 0.0200 105 MN 46.207077026 39.986907959 73.991729736 GLY 49 hn 0.2800 106 MA1 45.620616913 41.460151672 71.317451477 GLY 49 h 0.1000 107 MA2 46.357063293 42.283206940 72.672386169 GLY 49 h 0.1000 108 C 47.682319641 40.950855255 71.600997925 GLY 49 c' 0.3800109 O 48.560806274 41.811416626 71.601501465 GLY 49 o' -0.3800 110 N 47.842975616 39.718383789 71.091018677 HIS 50 n -0.5000 111 MN 46.947166443 39.222202301 71.052452087 HIS 50 hn 0.2800 112 CA 49.020114899 39.216835022 70.306198120 HIS 50 ca 0.1200 113 MA 49.324539185 38.296181652 70.836235046 HIS 50 h 0.1000 114 C 50.400863647 39.993576050 70.182159941 HIS 50 c' 0.3800 115 O 50.733478546 40.446022034 69.081466675 HIS 50 o' -0.3800 116 CB 48.455345154 38.673969269 68.953773499 HIS 50c2 -0.2000 117 HB1 49.238502502 38.051708221 68.481765747 HIS 50 h 0.1000 118 HB2 47.639427185 37.951225281 69.144165039 HIS 50 h 0.1000 119 CG 47.954322815 39.695293427 67.919425964 HIS 50 c5 0.1000 120 MD1 46.759342194 40.404747009 68.035293579HIS 50 np -0.4200 121 CE1 46.825572968 41.133701324 66.873245239 HIS 50 c5 0.2700 122 NE2 47.887611389 40.964004517 66.014495850 HIS 50 np -0.5000 123 CD2 48.617565155 40.019775391 66.717041016 HIS 50 c5

0.0100 124 ME1 46.043247223 41.852840424 66.655242920 HIS 50 h 0.1300 125 ME2 48.092224121 41.403381348 65.108955383 HIS 50 hn 0.2800 126 MD2 49.566501617 39.599807739 66.396347046 HIS 50 h 0.1300 127 N 51.278770447 40.10548019471.226615906 PRO 51 n -0.4200 128 CA 52.667034149 40.618915558 71.077911377 PRO 51 ca 0.0600 129 MA 52.723186493 41.393623352 70.287094116 PRO 51 h 0.1000 130 CD 50.956447601 39.767082214 72.624496469 PRO 51 c2 0.0600 131 MD1 50.92097091738.670558929 72.747383118 PRO 51 h 0.1000 132 MD2 49.988422394 40.190521240 72.947166443 PRO 51 h 0.1000 133 C 53.707103729 39.478122711 70.804489136 PRO 51 c' 0.3800 134 O 53.623699188 38.391666412 71.391418457 PRO 51 o' -0.3800 135 CB52.846694946 41.283794403 72.455955505 PRO 51 c2 -0.2000 136 MB1 53.907955170 41.442169189 72.729286194 PRO 51 h 0.1000 137 MB2 52.373264313 42.285846710 72.449127197 PRO 51 h 0.1000 138 CG 52.105823517 40.370025635 73.440398170 PRO 51 c2 -0.2000139 MG1 52.782051086 39.565395355 73.789718628 PRO 51 h 0.1000 140 MG2 51.753723145 40.912036896 74.337333679 PRO 51 h 0.1000 141 N 54.704883575 39.729522705 69.933471680 LEU 52 n -0.5000 142 CA 55.791530609 35.746330261 69.603820801 LEU 52 ca 0.1200 143 MN 54.653743744 40.652229308 69.490356445 LEU 52 hn 0.2800 144 MA 56.479202271 39.288208008 68.927917480 LEU 52 h 0.1000 145 C 35.301837921 37.525024414 68.745040894 LEU 52 c' 0.3800 146 O 55.637695313 37.425930023 67.562049866 LEU 52o' -0.3800 147 CB 56.671585083 38.316761017 70.829437256 LEU 52 c2 -0.2000 148 MB1 56.036743164 37.710464478 71.502593994 LEU 52 h 0.1000 149 MB2 57.445541382 37.602729797 70.487434387 LEU 52 h 0.1000 150 CG 57.363307953 39.420749664 71.675102234LEU 52 c1 -0.1000 151 MG 56.617557526 40.200679779 71.926834106 LEU 52 h 0.1000 152 CD1 57.875057220 38.833915710 73.004547119 LEU 52 c3 -0.3000 153 MD11 58.353130341 39.601875305 73.642135620 LEU 52 h 0.1000 154 MD12 57.048751831 38.40395736773.601577759 LEU 52 h 0.1000 155 MD13 58.618564606 38.028480530 72.852462769 LEU 52 h 0.1000 156 CD2 58.531608582 40.085853577 70.927200317 LEU 52 c3 -0.3000 157 MD21 59.028976440 40.857166290 71.545303345 LEU 52 h 0.1000 158 MD22 59.30950927739.355545044 70.634819031 LEU 52 h 0.1000 159 MD23 58.192760468 40.592193604 70.005569458 LEU 52 h 0.1000 160 N 54.534648895 36.601863861 69.354270935 ALA 53 h -0.5000 161 CA 53.940563202 35.420303345 68.673507690 ALA 53 ca 0.1200 162 MN54.159572601 36.958141327 70.246543884 ALA 53 hn 0.2800 163 HA 53.600482941 35.753322601 67.671340942 ALA 53 h 0.1000 164 C 52.639778137 34.883575439 69.383995056 ALA 53 c' 0.3800 165 O 51.628326416 34.818698883 68.677047729 ALA 53 o' -0.3800 166 CB 55.008785248 34.330768585 68.423698425 ALA 53 c3 -0.3000 167 MB1 54.582756042 33.460170746 67.892036438 ALA 53 h 0.1000 168 MB2 55.828662872 34.711517334 67.787284851 ALA 53 h 0.1000 169 MB3 55.479701896 33.961406708 69.351325989 ALA 53 h 0.1000 170 N 52.555103302 34.484893799 70.698265076 PRO 54 n -0.4200 171 CA 51.304950714 33.917499542 71.286506653 PRO 54 ca 0.0600 172 MA 50.878768921 33.172523499 71.584587097 PRO 54 h 0.1000 173 CD 53.705833435 34.435420990 71.626182556 PRO 54c2 0.0600 174 MD1 54.215991974 35.409980774 71.739936829 PRO 54 h 0.1000 175 MD2 54.453365326 33.693523407 71.288909912 PRO 54 h 0.1000 176 C 50.177021027 34.945980072 71.642837524 PRO 54 c' 0.3800 177 O 50.377983093 36.164409637 71.677795410 PRO54 o' -0.3800 178 CB 51.867893219 33.173828125 72.519187927 PRO 54 c2 -0.2000 179 MB1 51.135505676 33.051830292 73.340660095 PRO 54 h 0.1000 180 MB2 52.181377411 32.150829315 72.232276917 PRO 54 h 0.1000 181 CG 53.087123871 33.98919296372.949317932 PRO 54 c2 -0.2000 182 MG1 52.768703461 34.871643066 73.538475037 PRO 54 h 0.1000 183 MG2 53.791828156 33.414070129 73.579086304 PRO 54 h 0.1000 184 N 48.977436066 34.414421082 71.936706543 GLY 55 n 0.5000 185 CA 47.82262039235.225021362 72.404747009 GLY 55 cg 0.0200 186 MN 48.958133698 33.389709473 71.929512024 GLY 55 hn 0.2800 187 MA1 47.830284119 36.238574982 71.983676453 GLY 55 h 0.1000 188 MA2 46.896526337 34.772380829 72.004432678 GLY 55 h 0.1000 189 C47.670829773 35.263648987 73.950416565 GLY 55 c' 0.3800 190 O 47.247509003 34.242198944 74.498336792 GLY 55 o' -0.3800 191 N 47.956153870 36.372848511 74.696281433 PRO 56 n -0.4200 192 CA 47.830066681 36.396587372 76.179130554 PRO 56 ca 0.0600 193 MA 48.225147247 35.457695007 76.619560242 PRO 56 h 0.1000 194 CD 48.653686523 37.556163788 74.163940430 PRO 56 c2 0.0600 195 MD1 48.108860016 38.040233612 73.332565308 PRO 56 h 0.1000 196 MD2 49.652721405 37.256084442 73.799308777 PRO 56 h 0.1000197 C 46.361907959 36.804877472 76.668052673 PRO 56 c' 0.3800 198 O 45.890090942 37.732730865 76.845039368 PRO 56 o' -0.3800 199 CB 48.804897308 37.531764984 76.560951233 PRO 56 c2 -0.2000 200 MB1 48.542221069 38.034294128 77.511970520 PRO 56 h 0.1000 201 MB2 49.825592041 37.124942236 76.697402954 PRO 56 h 0.1000 202 CG 48.782566071 38.488700867 75.368530273 PRO 56 c2 -0.2000 203 MG1 47.903289795 39.158111572 75.434867859 PRO 56 h 0.1000 204 MG2 49.679012299 39.133480072 75.321792603 PRO56 h 0.1000 205 N 45.650573730 35.488880157 76.896896362 HIS 57 n -0.5000 206 MN 46.046119690 34.657379150 76.439048767 HIS 57 hn 0.2800 207 CA 44.244419098 35.504474640 77.387596130 HIS 57 ca 0.1200 208 MA 43.667560577 36.207649231 76.759368896HIS 57 h 0.1000 209 C 44.173530579 35.943927765 78.901000977 HIS 57 c' 0.3800 210 O 44.750030518 35.234142303 79.736030579 HIS 57 o' -0.3800 211 CB 43.610416412 34.095542908 77.185058594 HIS 57 c2 -0.2000 212 MB1 44.270858765 33.32379531977.623748779 HIS 57 h 0.1000 213 MB2 42.689029694 34.034877777 77.796188354 HIS 57 h 0.1000 214 CB 43.250400543 33.671833038 75.751731873 HIS 57 c5 0.1000 215 MD1 44.116428375 33.723646257 74.666069031 HIS 57 np -0.4200 216 CE1 43.32597351133.139041901 73.713264465 HIS 57 c5 0.2700 217 ME2 42.066158295 32.716590881 74.036811829 HIS 57 np -0.5000 218 CD2 42.045005798 33.048488617 75.379264832 HIS 57 c5 0.0100 219 ME1 43.722070465 33.001682281 72.711807251 HIS 57 h 0.1300 220 ME241.370864868 32.229383759 73.464263916 HIS 57 hn 0.3800 221 MD2 41.236827850 32.815635681 76.058380127 HIS 57 h 0.1300 222 N 43.513858795 37.068405151 79.318038940 PRO 58 n -0.4200 223 CA 43.593978882 37.569736481 80.719970703 PRO 58 ca 0.0600 224 MA 44.657642365 37.630668640 81.026939392 PRO 58 h 0.1000 225 CD 42.833599091 38.010932922 78.407653809 PRO 58 c2 0.0600 226 MD1 42.093353271 37.516807556 77.751007080 PRO 58 h 0.1000 227 MD2 43.569110870 38.527889252 77.758674622 PRO 58 h 0.1000228 C 42.805988312 36.695770264 81.747009277 PRO 58 c' 0.3800 229 O 41.569808960 36.693984985 81.769706726 PRO 58 o' -0.3800 230 CB 43.072513580 39.016571045 80.579101563 PRO 58 c2 -0.2000 231 MB1 42.559799194 39.392253876 81.485702515 PRO 58 h 0.1000 232 MB2 43.920654297 39.706352234 80.398040771 PRO 58 h 0.1000 233 CG 42.156440735 38.999496460 79.353399631 PRO 58 c2 -0.2000 234 MG1 41.151851654 38.629653931 79.634307861 PRO 58 h 0.1000 235 MG2 42.023620605 39.998752594 78.896965027 PRO58 h 0.1000 236 N 43.540618896 35.961261749 82.605430603 ALA 59 n -0.5000 237 MN 44.537330627 35.932937622 82.365699768 ALA 59 hn 0.2800 238 CA 42.949653625 34.946208954 83.526855469 ALA 59 ca 0.1200 239 MA 42.197692871 34.355514526 82.965911865ALA 59 h 0.1000 240 C 42.208984375 35.488883972 84.803985596 ALA 59 c' 0.3800 241 O 42.496433258 35.127353668 85.948333740 ALA 59 o' -0.3800 242 CB 44.107444763 33.975612640 83.839767456 ALA 59 c3 -0.3000 243 MB1 43.761249542 33.13053894084.463287354 ALA 59 h 0.1000 244 MB2 44.544620514 33.531585693 82.924507141 ALA 59 h 0.1000 245 MB3 44.925910950 34.467308044 84.399597168 ALA 59 h 0.1000 246 N 41.192062378 36.323741913 84.559051514 ALA 60 n -0.5000 247 MN 41.12454986636.554992676 83.555343628 ALA 60 hn 0.2800 248 CA 40.203086853 36.790748596 85.562988281 ALA 60 ca 0.1200 249

MA 40.023948669 35.965785980 86.283721924 ALA 60 h 0.1000 250 C 38.823528290 37.027305602 84.846977234 ALA 60 c' 0.3800 251 O 37.897804260 36.283885956 85.186340332 ALA 60 o' -0.3800 252 CB 40.756233215 37.971691132 86.389617920 ALA 60 c3 -0.3000 253 MB1 40.004146578 38.357006073 87.102043152 ALA 60 h 0.1000 254 MB2 41.631908417 37.656120300 86.987319946 ALA 60 h 0.1000 255 MB3 41.090072632 38.818138123 85.765472412 ALA 60 h 0.1000 256 N 38.616340637 37.921970367 83.823921204 PRO61 n -0.4200 257 CA 37.403762817 37.874496460 82.948486328 PRO 61 ca 0.0600 258 MA 36.491020223 37.824863434 83.573593140 PRO 61 h 0.1000 259 CD 39.556003571 39.003845215 83.459777832 PRO 61 c2 0.0600 260 MD1 40.594814301 38.65815805283.304046631 PRO 61 h 0.1000 261 MD2 39.571029663 39.778694153 84.250648498 PRO 61 h 0.1000 262 C 37.275394440 36.712963104 81.892074585 PRO 61 c' 0.3800 263 O 36.366387939 36.670307159 81.183484568 PRO 61 o' -0.3800 264 CB 37.47385788039.266963959 82.286987305 PRO 61 c2 -0.2000 265 MB1 36.949714661 39.321308136 81.312759399 PRO 61 h 0.1000 266 MB2 36.985511780 40.017913818 82.938987732 PRO 61 h 0.1000 267 CG 38.968631744 39.571613312 82.168632507 PRO 61 c2 -0.2000 268 HG139.397396088 39.046298981 81.292793274 PRO 61 h 0.1000 269 HG2 39.180202484 40.649600983 82.039207458 PRO 61 h 0.1000 270 N 38.242324829 35.777751923 81.785034180 SER 62 n -0.5000 271 CA 38.186004639 34.624855042 80.844123840 SER 62 ca 0.1200 272 MN 39.035541534 35.827360535 82.416992185 SER 62 hn 0.2800 273 MA 37.921787262 35.006183624 79.841125488 SER 62 h 0.1000 274 C 37.145660400 33.532897949 81.261909485 SER 62 c' 0.3800 275 O 37.466091156 32.626064301 82.041137695 SER 62 o' -0.3800276 CB 39.620265961 34.048240662 80.725196835 SER 62 c2 -0.1700 277 MB1 39.660293579 33.306644440 79.904281616 SER 62 h 0.1000 278 MB2 40.349685669 34.832687378 80.442802429 SER 62 h 0.1000 279 OG 40.032703400 33.414188385 81.938880920 SER 62 oh -0.3800 280 MG 39.252223969 32.931293488 82.256263733 SER 62 ho 0.3500 281 N 35.902244568 33.647918701 80.764541626 SER 63 n -0.5000 282 CA 34.747528076 32.874965942 81.297317505 SER 63 cg 0.1200 283 MN 35.768447876 34.503852844 80.205200195 SER63 hn 0.2800 284 MA 35.064254761 32.265518188 82.170570374 SER 63 h 0.1000 285 C 34.106758118 31.936998367 80.231674194 SER 63 c' 0.3800 286 O 33.716896657 32.367130280 79.142120361 SER 63 o' -0.3800 287 CB 33.716815948 33.889484406 81.843544006SER 63 c2 -0.1700 288 MB1 34.199871063 34.571354430 82.572105408 SER 63 h 0.1000 289 MB2 33.22880719 34.543502808 81.036796570 SER 63 h 0.1000 290 OG 33.634590149 33.222091675 82.496467590 SER 63 oh -0.3800 291 MG 32.159793854 32.71040725781.832328796 SER 63 ho 0.3500 292 N 33.914913177 30.658897400 80.588378906 TRP 64 n -0.5000 293 CA 33.112319946 29.694124222 79.783546448 TRP 64 ca 0.1200 294 MN 34.221500397 30.422899246 81.538955658 TRP 64 hn 0.2800 295 MA 33.40473175029.812168121 78.721931458 TRP 64 h 0.1000 296 C 31.573041916 29.961977005 79.883049011 TRP 64 c' 0.3800 297 O 30.996980667 29.940891266 80.975959778 TRP 64 o' -0.3800 298 CB 33.525466919 26.235471725 80.142707825 TRP 64 c2 -0.2000 299 MB132.950366974 27.534402847 79.508041382 TRP 64 h 0.1000 300 MB2 34.571674347 28.078489304 79.816658020 TRP 64 h 0.1000 301 CG 33.405326843 27.783784866 81.611763000 TRP 64 c5 0.0000 302 CD1 32.267101288 27.214570999 82.221214294 TRP 64 c5 0.1000303 NE1 32.481933594 26.953943253 83.590408325 TRP 64 np -0.5000 304 CE2 33.781952422 27.378627777 83.812339783 TRP 64 c5 0.1100 305 CD2 34.355152230 27.881061554 82.617965698 TRP 64 c5 0.0000 306 MD1 31.322025528 27.036033630 81.708480835 TRP 64h 0.1000 307 ME1 31.820940018 26.578481674 84.279945374 TRP 64 hn 0.2800 308 CE3 35.681034088 28.394184113 82.615905762 TRP 64 cp -0.1000 309 ME3 36.128986359 28.784986496 81.714393616 TRP 64 h 0.1000 310 CE3 36.396430969 28.38719177283.815704346 TRP 64 cp -0.1000 311 ME3 37.405311584 28.776082993 83.832160950 TRP 64 h -0.1000 312 CM2 35.830604553 27.888952255 84.994210925 TRP 64 cp 0.1000 313 MM2 36.410472870 27.896844844 85.506951904 TRP 64 h 0.1000 314 CZ2 34.52723312427.382776260 85.014289856 TRP 64 cp 0.1000 315 MZ2 34.097515106 27.006088257 85.929389954 TRP 64 h 0.1000 316 N 30.921349498 30.232547760 78.740600586 GLY 65 n 0.5000 317 CA 29.460748672 30.504768372 78.692192078 GLY 65 cg 0.0200 318 MN31.520374298 30.302478790 77.901519775 GLY 65 hn 0.2800 319 MA1 29.073087692 30.896234512 79.650825500 GLY 65 h 0.1000 320 MA2 29.288171768 31.333106995 77.981094360 GLY 65 h 0.1000 321 C 28.633579254 29.293350220 78.197364807 GLY 65 c' 0.3800 322 O 25.866907883 29.137302399 76.975486755 GLY 65 o' -0.3800 323 N 27.969013672 28.429246902 79.038352966 PRO 66 n 0.0200 324 CA 27.282257080 27.212890625 78.846752930 PRO 66 ca 0.0600 325 MA 27.989650726 26.634012222 77.917152405 PRO 66 h 0.1000326 CD 28.016592026 28.832529831 80.511337280 PRO 66 c2 0.0600 327 MD1 27.731332779 29.836006927 80.880874634 PRO 66 h 0.1000 328 MD2 29.027824402 28.301166534 80.897590637 PRO 66 b 0.1000 329 C 25.977466583 27.479314804 77.725341797 PRO 66 c' 0.3800 330 O 25.217950821 25.417282104 77.982574463 PRO 66 o' -0.3800 331 CB 27.045602798 26.422634125 79.851196258 PRO 66 c2 -0.2000 332 MB1 26.132562637 25.797079086 79.827728271 PRO 66 h 0.1000 333 MB2 27.890687943 25.729280472 80.029365540 PRO66 h -0.1000 334 CG 27.003501892 27.477243423 80.958015442 PRO 66 c2 -0.2000 335 MG1 25.990892410 27.921483994 81.014678955 PRO 66 h 0.1000 336 MH2 27.232566833 27.061700821 81.956459045 PRO 66 h 0.1000 337 N 25.734319687 26.62640380976.719802856 ARG+ 67 n -0.5000 335 CA 24.603988647 26.793025970 75.767257690 ARG+ 67 ca 0.1200 339 MN 26.386735916 25.841371536 76.649803162 ARG+ 67 hn 0.2800 340 MA 24.496238708 27.874828339 75.561668396 ARG+ 67 h 0.1000 341 C 23.22746467626.224872589 76.267372131 ARG+ 67 c' 0.2800 342 O 23.178310394 25.034952164 76.603759766 ARG+ 67 o' -0.3800 343 CB 24.990055899 26.165229797 74.398826599 ARG+ 67 c2 -0.2000 344 MB1 24.135663986 26.318639755 73.709175110 ARG+ 67 h 0.1100 345 MB225.787433624 26.779323578 73.940032959 ARG+ 67 h 0.1100 346 CG 25.439929962 24.676465988 74.361564636 ARG+ 67 c2 -0.2000 347 MG1 26.546255112 24.646316528 74.415458679 ARG+ 67 h 0.1300 348 MG2 25.092346191 24.131168365 75.261718750 ARG+ 67 h 0.1300 349 CD 24.934387207 23.941221237 73.112297058 ARG+ 67 c2 -0.0900 350 MD 23.838283539 23.774566650 73.188652039 ARG+ 67 h 0.1300 351 MD2 25.070211411 24.585262299 72.220893860 ARG+ 67 h 0.1300 352 ME 25.665744781 22.657058716 72.968780518ARG+ 67 n1 -0.5000 353 ME 26.251846313 22.313375473 73.731925964 ARG+ 67 hn 0.3600 354 CZ 25.689014435 21.902687073 71.871635437 ARG+ 67 cr 0.4500 355 MM1 26.493299484 20.879484177 71.859733582 ARG+ 67 n2 -0.5000 356 M11 27.072875705 20.74095535372.690315247 ARG+ 67 hn 0.3600 357 MM12 26.520929337 20.119580078 71.006805420 ARG+ 67 hn 0.3600 358 MM2 24.956668854 22.117029190 70.805320740 ARG+ 67 n2 -0.5000 359 MM21 25.030595779 21.456792831 70.033142090 ARG+ 67 hn 0.3600 360 MM2224.266489029 22.916227341 70.550784302 ARG+ 67 hn 0.3600 361 N 22.080270767 26.971176147 76.244255066 ARG+ 68 n -0.4200 362 CA 20.743734360 24.358839035 76.485237122 PRO 68 ca 0.0600 363 MA 20.817556381 25.605155945 77.294357300 PRO 68 h 0.1000364 CD 22.076143265 28.448001862 76.342918396 PRO 68 c2 0.0600 365 MD1 22.539228439 25.949869I56 75.469612122 PRO 68 h 0.1000 366 MD2 22.632146835 25.776126862 77.244499207 PRO 68 h 0.1000 367 C 20.182382584 25.586324692 75.240180969 PRO 68 c' 0.3800 368 O 20.420539856 24.381649017 75.139877319 PRO 68 o' -0.3800 369 CB 19.948141098 27.549791336 77.062515259 PRO 68 c2 -0.2000 370 MB1 18.858430862 27.490163803 76.877128601 PRO 68 h 0.1000 371 MB2 20.066789627 27.567596436 78.163002014 PRO68 h 0.1000 372 CG 20.592071533 28.804227829 76.667755179 PRO 68 c2 -0.2000 373 MG1 20.158363342 29.031393051 75.478172302 PRO 68 h 0.1000 374 MG2 20.428398132 29.704229355 77.092338562 PRO 68 h

0.1000 375 N 19.458055496 26.229068756 74.300010681 ARG+ 69 n -0.5000 376 CA 18.893756866 25.542047501 73.096710205 ARG+ 69 ca 0.1200 377 MN 19.221296310 27.198928833 74.529014587 ARG+ 69 hn 0.2800 378 MA 19.667610168 24.87246131972.660797119 ARG+ 69 h 0.1000 379 C 18.514461517 26.608341217 72.012504375 ARG+ 69 c' 0.3800 380 O 17.383218765 27.099323273 72.036094666 ARG+ 69 o' -0.3800 381 CB 17.681777954 24.654710770 73.539657593 ARG+ 69 c2 -0.2000 352 MB1 18.01188468923.935596466 74.315147400 ARG+ 69 h 0.1100 383 MB2 16.954420090 25.310214996 74.061965942 ARG+ 69 h 0.100 384 CG 16.946891785 23.862810135 72.427490234 ARG+ 69 c2 -0.2000 385 MG1 16.649517059 24.851628113 71.612152100 ARG+ 69 h 0.1300 386 MG217.638776779 23.127803802 71.968805054 ARG+ 69 h 0.1300 387 CD 15.688191414 23.166488647 72.975959775 ARG+ 69 c2 -0.9000 388 MD1 15.980383873 22.365550995 73.686569214 ARG+ 69 h 0.1300 389 MD2 15.090404510 23.898859024 73.554351807 ARG+ 69 h 0.1300 390 ME 14.889810562 22.612804413 71.848815915 ARG+ 69 n1 -0.5000 391 ME 15.272388458 22.616128922 70.898582458 ARG+ 69 hn 0.3600 392 CZ 13.644455910 22.143890381 71.942466736 ARG+ 69 cr 0.4500 393 MM1 13.048615456 21.755460739 70.850708005ARG+ 69 n2 -0.5000 394 MM11 13.576630592 21.832328796 69.979103058 ARG+ 69 hn 0.3600 395 MM12 12.090744019 21.411947250 70.936050933 ARG+ 69 hn 0.3600 396 MM2 12.989639282 22.056533813 73.074552507 ARG+ 69 n2 -0.5000 397 CZ 13.64445591022.143590381 71.942466736 ARG+ 69 cr 0.4500 393 MM1 13.048615456 21.755460739 70.850705008 ARG+ 69 n2 -0.500 394 MM11 13.576630592 21.822325796 69.979103088 ARG+ 69 hn 0.3600 395 MM12 12.090744019 21.411947250 70.936080933 ARG+ 69 hn 0.3600 396 MM2 12.989639282 22.056533813 73.074882507 ARG+ 69 n2 -0.5000 397 MM21 12.033639908 21.696094513 73.066261292 ARG+ 69 hn 0.3600 398 MM22 13.529273987 22.372974396 73.883934021 ARG+ 69 hn 0.3600 399 N 19.436628342 26.928932190 71.074501038 ARG+ 70 n -0.5000 400 CA 19.223009109 27.811206818 69.878326416 ARG+ 70 ca 0.1200 401 MN 20.357131958 26.451332092 71.165985107 ARG+ 70 hn 0.2800 402 MA 19.087514877 27.065124512 69.071128845 ARG+ 70 h 0.1000 403 C 20.512538910 28.575149536 69.398536682ARG+ 70 c' 0.3800 404 O 20.872812271 25.468791962 68.228363037 ARG+ 70 o' -0.3800 405 CB 17.935552597 28.697717667 69.732887268 ARG+ 70 c2 -0.2000 406 MB1 17.889257431 29.085472107 68.694030762 ARG+ 70 h 0.1100 407 MB2 17.053388596 28.03305816769.807891846 ARG+ 70 h 0.1100 408 CG 17.775762558 29.883768082 70.717842102 ARG+ 70 c2 -0.2000 409 MG1 18.004568100 29.946030045 71.747383118 ARG+ 70 h 0.1300 410 MG2 18.540782928 30.651863098 70.495643616 ARG+ 70 h 0.1300 411 CD 16.36811637930.502414703 70.693214417 ARG+ 70 c2 -0.0900 412 MD1 16.095691681 30.812221527 69.664886475 ARG+ 70 h 0.1300 413 MD2 15.630161285 29.711160660 70.937812805 ARG+ 70 h 0.1300 414 ME 16.255954742 31.590759277 71.711013794 ARG+ 70 n1 -0.5000 415 ME16.253637314 31.350564957 72.706428528 ARG+ 70 hn 0.3600 416 CE 16.144437790 32.900745392 71.464561462 ARG+ 70 cr 0.4500 417 MM1 16.055492401 33.712893625 72.481109619 ARG+ 70 n2 -0.5000 418 MM11 16.071464539 33.294216156 73.413330078 ARG+ 70 hn 0.3600 419 MM12 15.975571632 34.708621979 72.277374268 ARG+ 70 hn 0.3600 420 MM2 16.120351791 33.420074463 70.259872437 ARG+ 70 n2 -0.5000 421 MM21 16.025018692 34.432674408 70.167800903 ARG+ 70 hn 0.3600 422 MM22 16.187112808 32.73686218369.505996704 ARG+ 70 lm 0.3600 423 N 21.115812302 29.562902451 70.071769714 TYRC 71 n -0.5000 424 MN 21.515977859 30.157514572 69.338050842 TYRC 71 hn 0.2800 425 CA 22.034273148 29.314456940 71.218978882 TYRC 71 ca 0.1200 426 MA 22.67100906428.444923401 70.976676941 TYRC 71 h 0.1000 427 C 21.352920532 25.953493118 72.563385010 TYRC 71 c' 0.4100 428 OCT 20.392858505 29.553161621 73.048652649 TYRC 71 o' -0.3800 429 Q 21.928325653 27.853042603 73.145797729 TYRC 71 oh -0.3800 430 MO21.429273605 27.558662415 73.909782410 TYRC 71 ho 0.3500 431 CB 22.969152451 30.555358887 71.361984253 TYRC 71 c2 -0.2000 432 MB1 22.368267059 31.487627029 71.355415344 TYRC 71 h 0.1000 433 MB2 23.401992798 30.559690475 72.381835938 TYRC 71 h 0.1000 434 CG 24.144546509 30.666173935 70.352111816 TYRC 71 cp 0.0000 435 CD1 23.927537372 31.126276016 69.044418335 TYRC 71 cp -0.1000 436 MD1 22.944635391 31.424587630 68.717597961 TYRC 71 h 0.1000 437 CE1 24.987041473 31.212265015 68.143028259TYRC 71 cp -0.1000 438 ME1 24.819047928 31.555503845 67.131973267 TYRC 71 h 0.1000 439 CZ 26.273118973 30.861675262 68.542274475 TYRC 71 cp 0.0300 440 OM 27.314481735 30.957365036 67.652267456 TYRC 71 oh -0.3800 441 MN 26.980180740 31.23607063366.796859741 TYRC 71 ho 0.3500 442 CE2 26.504697800 30.422637939 69.841377258 TYRC 71 cp -0.1000 443 ME2 27.503232956 30.148866653 70.140815735 TYRC 71 h 0.1000 444 CD2 25.447391510 30.325349808 70.743820190 TYRC 71 cp -0.1000 445 MD225.652494431 29.968608856 71.745338440 TYRC 71 h 0.1000 446 *The numbering of the amino acids is shifted by minus 6 relative to the sequence SEQ ID No. 1.

TABLE NO. 2 residue atom type, Atom name and charge and name x y z no. no. N 24.753730401 26.435615520 68.246300542 CYSn 40 nj -0.500 1 CA 24.503000259 26.336292725 69.707687375 CYSn 40 ca 0.1200 2 NN1 23.561560822 26.42999267667.734397888 CYSn 40 hn 0.1400 3 NN2 25.250690460 25.603437424 67.909477234 CYSn 40 hn 0.1400 4 NA 23.590571594 27.247760773 69.940755269 CYSn 40 h 0.100 5 C 25.747190475 26.505004883 70.632949529 CYSn 40 c' 0.3800 6 O 25.611124039 27.20454216071.634971619 CYSn 40 o' -0.3800 7 CB 23.602088928 25.125436783 69.979545593 CYSn 40 c2 -0.3000 8 HB1 22.555475225 25.378625570 69.716011047 CYSn 40 h 0.1000 9 HB2 23.565217209 24.277284622 69.317871094 CYSn 40 h 0.1000 10 SG 23.62384201024.466741562 71.679084778 CYSn 40 s1 0.1000 11 N 26.910152435 25.8S1416321 70.350471497 SER 41 n -0.5000 12 CA 28.052598953 25.721915930 71.310394287 SET 41 ca 0.1200 13 HN 26.922674725 25.473436356 69.412322998 SER 41 hn 0.2800 14 RA27.761577606 24.886217117 71.978584290 SER 41 h 0.1000 15 C 28.477056503 26.929338455 72.226699529 SER 41 c' 0.3800 16 O 25.412267685 28.097608566 71.829902649 SER 41 o' -0.3800 17 CB 28.257335662 25.212779999 70.480110168 SER 41 c2 -0.1700 18 KB1 28.957101822 24.401222229 69.786743164 SER 41 h 0.1000 19 KB2 29.657650511 26.030597657 69.845893860 SER 41 h 0.1000 20 CG 30.284814825 24.713315964 71.339111328 SER 41 ch -0.3800 21 NG 31.027490616 24.448732376 70.755003662 SER 41 hc 0.350022 N 28.904022217 24.617259979 73.466476440 GLY 42 n -0.5000 23 CA 29.226711273 27.639400482 74.497131348 GLY 42 cg 0.0200 24 HX 29.140472412 25.626163483 73.587532043 GLY 42 hn 0.2800 25 KA1 28.567264557 28.519987106 74.394309988 GLY 42 h 0.100026 KA2 28.949186325 27.229663849 75.483924866 GLY 42 h 0.1000 27 C 30.728670120 28.040773392 74.587509155 GLY 42 c' 0.3800 28 O 31.522300720 27.171119690 74.961143494 GLY 42 o' -0.3800 29 N 31.175983429 29.296203613 74.282577515 PRO 43 n -0.420030 CA 32.627410889 29.612504959 74.140579224 PRO 43 ca 0.0600 31 KA 33.153442353 28.711788635 73.723632813 PRO 43 h 0.1000 32 CO 30.295356750 30.374078751 73.784042358 PRO 43 c2 0.0600 33 KD1 29.605636597 30.735929489 74.571166992 PRO 43 h 0.100034 KD2 29.653467865 30.826647568 72.928161621 PRO 43 h 0.1000 35 C 33.389945984 30.112844467 75.429031372 PRO 43 c' 0.3800 36 O 32.754360199 30.681560516 76.327354431 PRO 43 o' -0.3800 37 CB 32.565906525 30.710325241 73.057388306 PRO 43 c2 -0.2000 38 KB1 33.449081421 31.378034592 73.055488586 PRO 43 h 0.1000 39 KB2 31.524932861 30.247560501 72.051818848 PRO 43 h 0.1000 40 CG 31.263490677 31.466632843 73.332626343 PRO 43 c2 -0.2000 41 KG1 31.413110733 32.204200745 74.146759733 PRO 43h 0.1000 42 KG2 30.894020081 32.022109985 72.450286865 PRO 43 h 0.1000 43 N 34.754848480 30.015562057 75.523460388 PRO 44 n -0.4200 44 CA 35.553565979 30.763086319 76.536285400 PRO 44 ca 0.6000 45 KA 35.083564758 30.695350647 77.536567688 PRD 44h 0.1000 46 CD 35.574893951 29.325835648 74.665214519 PRO 44 c2 0.0600 47 KD1 35.471595764 29.373666763 73.588935852 PRO 44 h 0.1000 48 KD2 35.281650543 28.076414108 74.807395935 PRO 44 h 0.1000 49 C 35.767509460 32.265411377 76.141123281 PRO 44c' 0.3300 50 O 36.544441223 32.599441528 75.238464355 PRD 44 o' 0.3800 51 CB 36.549227905 29.927103043 76.567779541 PRO 44 c2 -0.2000 52 HB1 37.732776642 30.502979279 76.899909705 PRO 44 h 0.1000 53 HB2 36.733722657 29.095364598 72.253833069 PRO44 h 0.1000 54 CG 37.005489349 29.369808197 75.152618408 PRO 44 c2 -0.2000 55 MG1 37.502185822 30.119005203 74.504158020 PRO 44 h 0.1000 56 MG2 37.625408173 28.451385498 75.115615845 PRO 44 h 0.1000 57 N 35.047088623 33.173435211 76.816978455 ALA45 n -0.5000 58 CA 35.021333466 34.699920502 76.449218750 ALA 45 ca 0.1200 59 MN 34.471403029 32.798248291 77.590728760 ALA 45 hn 0.2800 60 HA 35.065380096 34.699813843 75.343650818 ALA 45 h 0.1000 61 C 36.187728882 35.414947510 77.090148926 ALA45 c' 0.3800 62 O 36.133388519 35.819305420 78.255142212 ALA 45 o' -0.3800 63 CB 33.615478516 35.135440826 76.831176758 ALA 45 c3 -0.3000 64 HB1 33.490375519 36.157480927 76.517280579 ALA 45 h 0.1000 65 HB2 32.811222076 34.556259155 76.338432312ALA 45 h 0.1000 66 HB3 33.433517456 35.098365784 77.922439575 ALA 45 h 0.1000 67 N 37.264499664 35.613568713 76.306388855 ALA 46 n -0.5000 68 HN 37.248532703 35.072978973 75.433502197 ALA 46 hn 0.2800 69 CA 38.503662109 36.398694611 76.764076233ALA 46 ca 0.1200 70 MA 38.303600311 36.883266449 77.688095093 ALA 46 h 0.1000 71 C 39.082061765 37.173509979 75.687866211 ALA 46 c' 0.3800 72 O 38.951850891 37.052509308 74.481193542 ALA 46 c' 0.3800 73 CB 39.509185791 35.179004669 77.103065491ALA 46 c3 -0.3000 74 HB1 40.441535950 35.582756042 77.525072327 ALA 46 h 0.1000 75 HB2 39.106670380 34.460605622 77.839447021 ALA 46 h 0.1000 76 HB3 39.780502319 34.997728729 76.205062866 ALA 46 h 0.1000 77 N 39.768814087 38.34406662076.133750916 ALA 47 n 0.5000 78 CA 40.322643280 39.391151428 75.225708008 ALA 47 ca 0.1200 79 MN 39.783836365 38.455593109 77.149337769 ALA 47 hn 0.2800 80 HA 39.932807922 39.265201569 74.196365356 ALA 47 h 0.1000 81 C 41.900882721 39.40157481775.126977349 ALA 47 c' 0.3800 82 O 42.538444519 40.171451569 75.854652405 ALA 47 o' -0.3800 83 CB 39.728843659 40.731719971 75.714279175 ALA 47 c3 -0.3000 84 HB1 40.043342590 41.567916570 75.059875488 ALA 47 h 0.1000 85 HB2 38.62197876040.726497630 75.711242676 ALA 47 h 0.1000 86 HB3 40.062076569 40.987442017 76.739311218 ALA 47 h 0.1000 87 N 42.578651428 38.603999056 74.242019653 PRO 48 n -0.4200 88 CA 44.052674976 38.702857971 74.013595581 PRO 48 ca 0.0600 89 HA 44.57603454638.850185394 74.977058411 PRO 48 h 0.1020 90 CO 41.956359863 37.474979401 73.520225525 PRO 48 c2 0.0600 91 HD1 41.114963531 37.378272858 72.872795105 PRO 48 h 0.1000 92 HD2 41.576156616 36.723918915 74.239135742 PRO 48 h 0.1000 93 C 44.49245834439.820354462 73.002609253 PRO 48 c' 0.3800 94 O 43.782276154 40.131282806 72.040626526 PRO 48 o' -0.3800 95 CB 44.356296539 37.288743516 73.479736328 PRO 48 c2 -0.2000 96 HB1 45.273612976 37.234390259 72.865592957 PRO 48 h 0.1000 97 HB244.813816833 36.591526031 74.322021484 PRO 48 h 0.1000 98 CG 43.102409363 36.884414673 72.702988770 PRO 48 c2 -0.2000 99 HG1 43.119277954 37.331111908 71.685241699 PRO 48 h 0.1000 100 HG2 43.010280609 35.788948059 72.572326660 PRO 48 h 0.1000 101 N 45.709655762 40.366821289 73.185493469 GLY 49 n -0.5000 102 CA 46.317604065 41.332912445 72.214889526 GLY 49 cg 0.0200 103 HN 46.169986725 40.089691162 74.058357239 GLY 49 hn 0.2800 104 HA1 45.654991150 41.537052153 71.351181020 GLY 49 h 0.1000105 HA2 46.406318665 42.313266754 72.719123840 GLY 49 b 0.1000 106 C 47.710880280 40.963481903 71.854037476 GLY 49 c' 0.3800 107 O 48.630664825 41.772521973 71.754951477 GLY 49 o' -0.3800 108 N 47.830738068 39.763301849 71.063682556 HIS 50 n -0.5000 109 HN 46.918842316 39.310573578 70.943237305 HIS 50 hn 0.2800 110 CA 49.045799255 39.210880280 70.375061035 HIS 50 ca 0.1200 111 HA 49.315334220 38.320884705 70.972137451 HIS 50 h 0.1000 112 C 50.433021545 39.981941223 70.267852783 HIS 50c' 0.3800 113 O 50.773132324 40.456230164 69.178672791 HIS 50 o' -0.3800 114 CB 28.558776855 32.590164165 69.024101257 HIS 50 c2 -0.2000 115 HB1 49.390335083 32.009521484 68.577232361 HIS 50 h 0.1000 116 HB2 47.792594910 37.817192078 69.227330181HIS 50 b 0.1000 117 CG 47.597627258 39.545143127 67.956726074 HIS 50 c5 0.1000 118 HD1 46.669281006 39.956676482 67.918121338 HIS 50 np 0.1000 119 CE1 46.730144501 40.789539337 66.829002380 HIS 50 c5 0.2700 120 NE2 47.911670685 40.95061492966.152328491 HIS 50 np -0.5000 121 CD2 48.729324341 40.126430511 66.304235840 HIS 50 c5 0.0100 122 HE1 45.843067169 41.327060699 66.517631531 HIS 50 h 0.1300 123 HE2 48.138290425 41.548683167 65.349815369 HIS 50 hn

0.2800 124 HB2 49.789726257 39.981491089 66.738136292 HIS 50 h 0.1300 125 H 51.307849884 40.071182251 71.317932129 PRO 51 n -0.4200 126 CA 52.692558239 40.596851349 71.184913635 PRO 51 ca 0.0600 127 HA 52.742668152 41.39051055970.412712097 PRO 51 h 0.1000 128 CD 50.980678558 39.703777313 72.706970215 PRO 51 c2 0.0600 129 HD1 50.998199463 38.605384827 72.818397522 PRO 51 h 0.1000 130 HD2 49.987606049 40.071315765 73.019950867 PRO 51 b 0.1000 131 C 53.73906326339.471630096 70.880722046 PRO 51 c' 0.3800 132 O 53.708900452 38.294466400 71.488830566 PRO 51 c' -0.2800 133 CB 52.868911743 41.240936279 72.572486877 PRO 51 c2 0.2000 134 HB1 53.929355621 41.264253998 72.864852905 PRO 51 b 0.1000 135 HB252.429229736 42.258647919 72.365872192 PRO 51 h 0.1000 136 CG 52.087848663 40.349472046 73.547019958 PRO 51 c2 -0.2000 137 HG1 51.750400543 39.566276550 73.963310242 PRO 51 h 0.1000 138 HG2 51.686916351 40.923263550 74.403717041 PRO 51 h 0.1000139 H 54.676445007 39.726749420 69.946899414 LEU 52 n -0.5000 140 CA 55.768096924 38.764469147 69.270259094 LEU 52 ca 0.1200 141 HN 54.573589325 40.637012482 69.488586426 LEU 52 hn 0.2800 142 HA 56.414031982 39.225927734 68.869346619 LEU 52 h 0.1000 143 C 55.281269073 37.240004730 68.718757629 LEU 52 c' 0.2800 144 O 55.654800415 37.411125183 67.550910950 LEU 52 o' -0.2800 145 CB 56.713882446 38.254763031 70.751991272 LEU 52 c2 -0.2000 146 HB1 56.125553131 37.737205505 71.456863403 LEU52 h 0.1000 147 HB2 57.488136292 37.658962250 70.274801636 LEU 52 h 0.1000 148 CG 57.411731720 39.487998962 71.552589417 LEU 52 c1 -0.1000 149 HG 56.652648926 40.244640350 71.834617615 LEU 52 h 0.1000 150 CD1 58.010108948 38.93694305472.859535217 LEU 52 c3 0.2000 151 HD11 58.475826263 39.735752106 73.467353821 LEU 52 h 0.1000 152 HD12 57.236072540 38.469894409 73.497505188 LEU 52 h 0.1000 153 HD13 38.787303925 38.171112061 72.675750732 LEU 52 h 0.1000 154 CD2 58.53762390140.187110901 70.742630205 LEU 52 c1 0.3000 155 HD21 58.993679047 41.001243591 71.321037292 LEU 52 b 0.1000 156 HD22 59.321178436 39.487018585 70.445312500 LEU 52 h 0.1000 157 HD23 58.125030518 40.647811890 69.818283082 LEU 52 b 0.1000 158 H54.475013733 36.643035889 69.215246582 ALA 53 n 0.5000 159 CA 53.896503448 35.451416016 68.639259338 ALA 53 ca 0.1200 160 HN 54.100524902 37.007503510 70.205250713 ALA 53 hn 0.2800 161 HA 53.553531647 35.773445129 67.634338379 ALA 53 h 0.1000 162 C 52.602260590 34.908508301 69.253744507 ALA 53 c' 0.3800 163 O 51.589200881 34.828308105 68.650024414 ALA 53 o' -0.3800 164 CB 54.970031738 34.364234924 68.394615173 ALA 53 c3 -0.3000 165 HB1 54.534633636 33.449993134 67.949513843 ALA 53 h 0.1000166 HB2 55.742454529 34.720954895 67.688003540 ALA 53 h 0.1000 167 HB3 55.500236511 34.068145752 69.316299435 ALA 53 h 0.1000 165 H 52.528435568 34.519321442 70.670552661 PRO 54 h -0.4200 169 CA 51.258402557 33.944232941 71.268875122 PRO 54 ca 0.0600 170 HA 50.560397339 33.194515228 70.573081970 PRO 54 h 0.1000 171 CD 53.678298950 34.513732910 71.601514270 PRO 54 c2 0.0600 172 HD1 54.146690369 35.509193420 71.717323303 PRO 54 h 0.1000 173 HD2 54.456559589 33.804157775 71.264945954 PRO54 h 0.1000 174 C 50.163700104 34.973747253 71.631501244 PRO 54 c' 0.3800 175 O 50.381851136 36.156935425 71.709472650 PRO 54 o' -0.3800 176 CB 51.868888855 33.209735870 72.497510364 PRO 54 c2 -0.2000 177 HB1 51.140216527 33.07192230273.319641113 PRO 54 h 0.1000 178 HB2 52.201725006 32.193626404 72.207275391 PRO 43 h 0.1000 179 CG 53.074722290 34.047100067 72.925216675 PRO 54 c2 -0.2000 180 HG1 52.742275235 34.920612335 73.520271301 PRO 54 h 0.1000 181 HG2 53.79415893633.482940674 73.547462463 PRO 54 h 0.1000 182 N 48.950717926 34.451953345 71.882225037 GLY 55 h -0.5000 183 CA 47.799011230 35.264900208 72.354157012 GLY 55 cg 0.2000 184 HN 48.913242340 33.427757262 71.533122253 GLY 55 hn 0.2800 185 HA147.529734802 36.291049957 71.943451445 GLY 55 h 0.1000 186 HA2 46.873668621 34.838525226 71.925056975 GLY 55 h 0.1000 187 C 47.624210355 35.262092590 73.898422241 GLY 55 c' 0.3800 188 O 47.184692353 34.228916165 74.411125183 GLY 55 o' -0.3800 189 N 47.910079956 36.345748901 74.679351507 PRO 56 n -0.4200 190 CA 47.789894104 36.319248199 76.162750244 PRO 56 ca 0.0600 191 HA 48.177116394 35.361667633 76.567420959 PRO 56 h 0.1000 192 CD 48.602729797 37.547939301 74.184952300 PRO 56 c2 0.0600193 HD1 48.046642303 35.065422058 73.380996704 PRO 56 h 0.1000 194 HD2 49.595470428 37.261715750 73.794556152 PRO 56 h 0.1000 195 C 46.326736450 36.529109955 76.663719177 PRO 56 c' 0.3800 196 O 45.857757568 37.657508850 76.842526843 PRO 56 o' 4.2800 197 CB 48.777050018 37.430667577 76.578651428 PRO 56 c2 4.2000 198 HB1 48.524734497 37.895471832 77.549573352 PRO 56 h 0.1000 199 HB2 49.795513153 37.009433746 76.691307068 PRO 56 h 0.1000 200 CG 48.752750397 35.431644440 75.422836304 PRO56 c2 -0.2000 201 HG1 47.879917145 39.105595450 75.522354126 PRO 56 h 0.1000 202 HG2 49.655212402 39.069591522 75.391311646 PRO 56 h 0.1000 203 N 45.616943359 35.415058136 76.897827148 HIS 57 n -0.5000 204 HN 46.014194489 34.57913589576.450401306 HIS 57 hn 0.2500 205 CA 44.212440491 35.434158325 77.393567493 HIS 57 ca 0.1100 206 HA 43.635601044 36.135776520 76.762800753 HIS 57 h 0.1000 207 C 44.146274567 35.852919312 75.904235540 HIS 57 c' 0.3800 208 O 44.71575381535.174930573 79.742973325 HIS 57 o' -0.3800 209 CB 43.577262578 34.025093079 77.198188782 HIS 57 c2 -0.2000 210 HB1 44.242053986 33.250709534 77.626457732 HIS 57 h 0.1000 211 HB2 42.665222165 33.964206696 77.822631536 HIS 57 h 0.1000 212 CG43.190551758 33.606594056 75.770996094 HIS 57 c5 0.1000 213 HD1 44.099815216 33.724720001 74.654500415 HIS 57 np -0.4200 214 CE1 43.220783234 33.103317261 73.724327087 HIS 57 c5 0.2700 215 HE1 42.000507355 32.603566577 74.087806702 HIS 57 np 0.5000 216 CD2 42.008693695 32.921348572 75.433784485 HIS 57 c5 0.0100 217 HE1 43.579235077 32.995296475 72.708923340 HIS 57 h 0.1300 218 HE2 41.324546514 32.061363220 73.538429260 HIS 57 hn 0.2500 219 HD2 41.238662720 32.635732910 76.138023376HIS 57 h 0.1300 220 N 43.493415833 37.014365150 79.314620972 PRO 58 n -0.4200 221 CA 43.576023102 37.521991730 80.713310242 PRO 58 ca 0.0600 222 HA 44.640773772 37.575522258 82.019523621 PRO 58 h 0.1000 233 CD 42.828823090 37.96018951975.395561215 PRO 58 c2 0.0600 224 HD1 42.088195801 37.471439362 77.735352080 PRO 58 h 0.1000 225 HD2 43.573791504 35.467678070 77.749885559 PRO 58 h 0.1000 226 C 42.782455444 36.660888672 81.747703552 PRO 55 c' 0.2500 227 O 41.54621124336.662254851 81.766304016 PRO 58 o' -0.3800 228 CB 43.067096710 38.972381592 80.563407898 PRO 58 c2 -0.2000 229 HB1 42.553604126 39.355644226 81.465919495 PRO 58 h 0.1000 230 HB2 43.922630310 39.652961731 80.282720947 PRO 58 h 0.1000 231 CG42.156223297 35.958541870 79.333923340 PRO 58 c2 -0.0200 232 HG1 41.146640778 38.599040985 79.611282349 PRO 58 h 0.1000 233 HG2 42.036239624 39.956802365 75.571780396 PRO 58 h 0.1010 234 N 43.511478424 35.934525351 82.617271423 ALA 59 n -0.5000235 HN 44.509765625 35.905010233 82.256589050 ALA 59 hn 0.2800 236 CA 42.913761139 34.928112030 83.544029236 ALA 59 ca 0.1200 237 HA 42.154701233 34.341350555 82.987930298 ALA 59 h 0.1000 238 C 42.151308746 35.481468201 84.521502656 ALA 59 c' 0.2800 239 O 42.459964752 35.112228394 85.965652466 ALA 59 o' -0.3800 240 CB 44.063701630 33.948829651 83.858291626 ALA 59 c3 -0.3000 241 HB1 43.708641052 33.104522705 84.478195190 ALA 59 h 0.1000 242 HB2 44.502014160 33.503505707 82.944122314 ALA59 h 0.1000 243 HB3 44.882900238 34.433902740 84.422813416 ALA 59 h 0.1000 244 N 41.178901672 36.333106995 84.577079773 ALA 60 n -0.5000 245 HN 41.112052917 36.562049866 83.573013306 ALA 60 hn 0.2800 246 CA 40.189502716 36.803413391 85.578857422ALA 60 ca 0.1200 247 HA 40.008514404 35.981742559 86.302818298 ALA 60 h 0.1000 248 C 38.811019597 37.037807465 84.860046387 ALA 60 c' 0.3800 249

O 37.881835938 36.301105499 85.205276489 ALA 60 o' -0.3800 250 CB 40.746566772 37.985549927 86.401313782 ALA 60 c3 -0.3000 251 HB1 39.997776031 38.372333527 87.116531372 ALA 60 h 0.1000 252 HB2 41.624504089 37.670467377 86.996170044 ALA 60h 0.1000 253 HB3 41.079444585 38.830841064 85.774902344 ALA 60 h 0.1000 254 N 38.609931946 37.922218323 83.826889035 PRO 61 n -0.4200 255 CA 37.398490906 37.873073578 82.950836182 PRO 61 ca 0.0600 256 HA 36.485267638 37.839759827 83.576164246 PRO61 h 0.1000 257 CD 39.352070615 39.001556396 83.460945129 PRO 61 c2 0.0600 258 HD1 40.590957642 38.653537750 83.311111430 PRO 61 h 0.1000 259 HD2 39.564567512 39.780746460 84.247795105 PRO 61 h 0.1000 260 C 37.256752532 36.700027466 81.909835515PRO 61 c' 0.3800 261 O 36.243316650 36.657413483 81.209106445 PRO 61 o' -0.3800 262 CB 37.477272034 39.256717652 82.271400452 PRO 61 c2 -0.2000 263 HB1 36.964195251 39.298637390 81.290786743 PRO 61 h 0.1000 264 HB2 36.951357574 40.01694488582.906776425 PRO 61 h 0.1000 265 CG 38.972518921 39.562160492 82.163795471 PRO 61 c2 -0.2000 266 HG1 39.409160614 39.034259796 81.293624578 PRO 61 h 0.1000 267 HG2 39.183399200 40.640045166 82.032295227 PRO 61 h 0.1000 268 N 38.21374130235.753643036 81.804443359 SER 62 n -0.5000 269 CA 38.144962311 34.600208282 80.863403320 SER 62 ca 0.1200 270 HN 39.020967804 35.895751953 82.434890747 SER 62 hn 0.2800 271 HA 37.892318726 34.983673096 79.856529236 SER 62 h 0.1000 272 C37.055021973 31.324326324 81.273231506 SER 62 c' 0.3800 273 O 37.352454436 32.625560760 82.070343018 SER 62 o' 0.3800 274 CB 39.569152532 33.994293213 80.760513306 SER 62 c2 -0.1700 275 HB1 39.601100922 33.242229462 79.949050903 SER 62 h 0.1000276 HB2 40.217050934 34.759819031 80.475799561 SER 62 h 0.1000 277 CG 39.955038330 33.367904663 81.986091614 SER 62 oh 0.1000 278 HG 39.157264709 32.925077698 82.316406250 SER 62 ho 0.3500 279 N 35.853912254 33.643447876 80.748901367 SER 63 n -0.5000 280 CA 34.681579590 32.893772125 81.280097961 SER 63 ca 0.1200 251 HN 35.734226227 34.507610321 80.200576782 SER 63 hn 0.2800 282 HA 34.978878021 32.281963345 82.158424377 SER 63 h 0.1000 283 C 34.028987885 31.963005066 80.214455165 SER 63c' 0.3800 254 O 33.624385534 32.404701233 79.134857178 SER 63 o' -0.3800 285 CB 33.674541473 33.937455035 81.815757751 SER 63 c2 -0.1700 286 HB1 34.172107697 34.614356995 82.538948059 SER 63 h 0.1000 287 HB2 33.303077695 34.594402313 81.003784180SER 63 h 0.1000 238 CG 31.576236725 33.301517487 82.471984863 SER 63 oh -0.3800 289 HG 32.084590912 32.806625366 81.807708740 SER 63 ho 0.3500 290 N 33.852622986 30.677625656 80.556045532 TRP 64 n -0.5000 291 CA 33.070865631 29.70941543679.732810974 TRP 64 ca 0.1200 292 HN 34.153343201 30.435497254 81.506057739 TRP 64 hn 0.2800 293 HA 33.375720978 29.840501785 78.676765442 TRP 64 h 0.1000 294 C 31.526346207 29.958730698 79.816452026 TRP 64 c' 0.3800 295 O 30.93673515329.911306351 80.900970459 TRP 64 o' -0.3800 296 CB 33.498536517 25.253648758 80.086425751 TRP 64 c2 -0.2000 297 HB1 32.936897276 27.550512314 79.442245483 TRP 64 h 0.1000 298 HB2 34.548812566 28.110004426 79.767990112 TRP 64 h 0.1000 299 CG33.372635702 27.788063049 81.551361084 TRP 64 c5 0.0000 300 CD1 32.236022969 27.198472977 82.145393372 TRP 64 c5 0.0100 301 HE1 32.442039490 26.926628113 83.513259888 TRP 64 np -0.5000 302 CE2 33.734771729 27.365074158 83.750877380 TRP 64 c5 0.1100 303 CD2 34.313194275 27.855219574 82.565856934 TRP 64 c5 0.0000 304 HD1 31.305589935 27.011001587 81.622375485 TRP 64 h 0.1000 305 HE1 31.781488419 26.532098770 84.192108154 TRP 64 hn 0.2800 306 CE3 35.633460999 28.410655975 85.581642151TRP 64 cp -0.1000 307 HE3 36.086208344 25.812973022 81.656943054 TRP 64 h 0.1000 308 CZ3 36.338203430 28.401332855 83.786201477 TRP 64 cp -0.1000 309 HZ3 37.342418671 28.800062180 83.816750090 TRP 64 h 0.1000 310 CH2 35.766292572 27.88748741184.956939697 TRP 64 cp -0.1000 311 HH2 36.336753845 27.895225525 85.875114441 TRP 64 h 0.1000 312 CZ2 34.469055176 27.367534637 84.959693909 TRP 64 cp -0.1000 313 HZ2 34.033626556 26.978825430 85.868453979 TRP 64 h 0.1000 314 N 30.88412666330.253189087 78.672058105 GLY 65 n -0.5000 315 CA 29.433704376 30.522933426 78.625785828 GLY 54 cg 0.0200 316 HN 31.490442276 30.324731827 77.837860107 GLY 65 hn 0.2800 317 HA1 29.049486160 30.927183151 79.604759216 GLY 65 h 0.1000 318 HA229.301883698 31.462034225 77.967575073 GLY 65 h 0.1000 319 C 28.566276550 29.436250687 78.049354553 GLY 65 c' 0.3800 320 O 28.476503372 29.383417130 76.820671082 GLY 65 o' -0.3800 321 N 27.919076920 28.520057678 78.830680847 PRO 66 n -0.4200 322 CA 27.254582451 27.307062149 78.266265869 PRO 66 ca 0.0600 323 HA 28.007204056 26.749544144 77.674018860 PRO 66 h 0.1000 324 CD 27.931732178 28.547025681 80.307373047 PRO 66 c2 0.0600 325 MD1 27.674114227 29.536535263 80.727989197 PRO 66 h 0.1000326 MD2 28.930458069 28.264209747 80.693565369 PRO 66 h 0.1000 327 C 25.991449356 27.540506363 77.367637634 PRO 66 c' 0.3800 328 O 25.234470367 28.498056412 77.550445557 PRO 66 o' -0.3800 329 CB 26.947065353 26.487516403 79.540168762 PRO 66 c2 -0.2000 330 HB1 26.021696091 25.883453369 79.667781067 PRO 66 h 0.1000 331 HB2 27.765922546 25.768106561 79.730659485 PRO 66 h 0.1000 332 CG 26.879997253 27.505201340 80.680580139 PRO 66 c2 -0.2000 333 HG1 25.878761292 27.974497401 80.712356567PRO 66 h 0.1000 334 HG2 27.057765961 27.053478241 81.674545288 PRO 66 h 0.1000 335 N 25.764133453 26.624628067 76.406608582 CYS 67 n -0.5000 336 CA 24.578670502 26.665664673 75.512832642 CYS 67 ca 0.1200 337 HN 26.474828720 25.89344978376.320098877 CYS 67 hn 0.2800 338 HA 24.437746048 27.701400757 75.152099609 CYS 67 h 0.1000 339 C 23.256376266 26.130277634 76.174392700 CYS 67 c' 0.3800 340 O 23.219629288 24.940492630 76.516906738 CYS 67 o' -0.3800 341 CB 24.90017509525.819908432 74.260444641 CYS 67 c2 -0.3000 342 HB1 25.807971954 26.178848267 73.749794106 CYS 67 h 0.1000 343 HB2 25.105169296 24.761932373 74.532623291 CYS 67 h 0.1000 344 CG 23.472158432 25.844451904 73.133270264 CYS 67 s1 0.1000 345 N22.124137878 26.895683289 76.264381409 PRO 68 n -0.4200 346 CA 20.786550522 26.297697067 76.829830933 PRO 69 ca 0.0600 347 HA 20.877141953 25.506265650 77.300582886 PRO 68 h 0.1000 348 CD 22.161409378 28.364057541 76.432929993 PRO 68 c2 0.0600 349 HB1 22.628620148 28.901371002 75.585960388 PRO 68 h 0.1000 350 HB2 22.732339859 28.631174088 77.345329285 PRO 68 h 0.1000 351 C 20.190311432 25.593938828 75.255737305 PRO 68 c' 0.3800 352 O 20.566764832 24.451507568 74.984413147 PRO 68 o' -0.3800353 CB 20.033475876 27.483673096 77.173645020 PRO 68 c2 -0.2000 354 HB1 18.940057755 27.449979782 77.017181396 PRO 68 h 0.1000 355 HB2 20.183664322 27.458950043 78.271354675 PRO 68 h 0.1000 356 CG 20.687761307 28.746078491 76.604209900 PRO 68 c2 -0.2000 357 HG1 20.234010696 29.017192841 75.632743835 PRO 68 h 0.1000 358 HG2 20.559530258 29.623554230 77.265640259 PRO 68 h 0.1000 359 N 19.297069550 26.226366043 74.460205078 ARG+ 69 n -0.5000 360 CA 18.727945328 25.594141006 73.229873657 ARG+69 ca 0.1200 361 HN 18.899488449 27.074655533 74.874603271 ARG+ 69 hn 0.2800 362 HA 19.468439102 24.889890671 72.798027039 ARG+ 69 h 0.1000 363 C 18.426181793 26.666866302 72.127845764 ARG+ 69 c' 0.3800 364 O 17.302417755 27.17032814072.057907104 ARG+ 69 o' -0.3800 365 CB 17.487716675 24.741283417 73.645401001 ARG+ 69 c2 -0.2000 366 HB1 17.790594101 24.038330078 74.447227478 ARG+ 69 h 0.1100 367 HB2 16.742151260 25.409061432 74.119949341 ARG+ 69 h 0.1100 368 CG 16.80657005323.930654526 72.510940552 ARG+ 69 c2 -0.2000 369 HG1 16.500089645 24.624885559 71.702163696 ARG+ 69 h 0.1300 370 HG2 17.539186478 23.235509872 72.053100586 ARG+ 69 h 0.1300 371 CD 15.574314117 23.148860931 73.007453918 ARG+ 69 c2 -0.0900 372 HD115.890284538 27.374292374 73.738624573 ARG+ 69 h 0.1300 373 HD2 14.902976036 23.843069077 73.554016113 ARG+ 69 h 0.1300 374 HZ 14.865127563 22.521680832 71.855873108 ARG+ 69 n1

-0.5000 375 HE 15.293711662 22.507183075 70.926025391 ARG+ 69 hn 0.3600 376 CZ 13.645489693 21.980854034 71.902374268 ARG+ 69 cr 0.4500 377 NH1 13.127552986 21.522832870 70.798370361 ARG+ 69 n2 -0.5000 378 NH11 13.689088821 21.60851862069.948852539 ARG+ 69 hn 0.3600 379 NH12 12.188611031 21.122539520 70.853851318 ARG+ 69 hn 0.3600 380 HN2 12.936479568 21.886768341 73.000465393 ARG+ 69 n2 -0.500 381 NH21 12.008401871 21.462900162 72.952354431 ARG+ 69 hn 0.3600 382 NH2213.405644417 22.251142502 73.831558228 ARG+ 69 hn 0.3600 383 N 19.430337904 26.966600418 71.273384094 ARG+ 70 n -0.5000 384 CA 19.316965103 27.784936905 70.016807556 ARG+ 70 ca 0.1200 385 HW 20.317523956 26.522159576 71.527793884 ARG+ 70 hn 0.2800386 HA 19.139877319 27.013025284 69.241798401 ARG+ 70 h 0.1000 387 C 20.690151215 28.397680283 69.573341370 ARG+ 70 c' 0.3800 385 O 21.267679214 27.963806152 68.579154968 ARG+ 70 o' -0.3800 389 CB 18.103752136 28.753581454 69.796676636 AR0+ 70 c2 -0.2000 390 HB1 18.134477615 29.133897751 68.754875153 ARG+ 70 h 0.1100 391 HB2 17.153977127 25.135446545 69.816154480 ARG+ 70 h 0.1100 392 CG 17.944366455 29.552959061 70.767364502 ARG+ 70 c2 -0.2000 393 HG1 18.201717377 29.630409241 71.795295715ARG+ 70 h 0.1300 394 HG2 18.686578751 30.737569809 70.523498535 ARG+ 70 h 0.1300 395 CD 16.516407013 30.528032303 70.757499695 ARG+ 70 c2 -0.0900 396 HD1 16.205293655 30.812314987 69.732495169 ARG+ 70 h 0.1300 397 HD2 15.804359436 29.72485923871.041206360 ARG+ 70 h 0.1300 398 HE 16.396289825 31.632033883 71.751823425 ARG+ 70 n1 -0.5000 399 NE 16.351929398 31.418577194 72.754444790 ARG+ 70 hn 0.3600 400 CE 16.270032883 32.931114197 71.475357056 ARG+ 70 cr 0.4500 401 HN1 16.11934280433.758121490 72.470024109 ARG+ 70 n2 -0.5000 402 HN11 16.097789764 33.352241516 73.407394409 ARG+ 70 hn 0.3600 403 HN12 16.020824432 34.751869202 72.242614746 ARG+ 70 hn 0.3600 404 NH2 16.295974731 33.427280426 70.262794495 ARG+ 70 n2 -0.5000 405 HN21 16.192591263 34.436058562 70.142570496 ARG+ 70 hn 0.3600 406 HN22 16.439620972 32.732715607 69.527351379 ARG+ 70 hn 0.3600 407 N 21.215826035 29.506198883 70.104598999 TYRC 71 n -0.5000 408 HN 21.692993164 29.961484909 69.319816589 TYRC 71 hn 0.2800 409 CA 21.037544250 29.469150543 71.348726365 TYRC 71 ca 0.1300 410 HA 22.727062225 28.601654053 71.296867371 TYRC 71 h 0.1000 411 C 21.230804443 29.295030594 72.663772583 TYRC 71 c' 0.4100 412 CKT 20.420524597 30.105148315 73.113685608TYRC 71 o' -0.3800 413 C 21.522385052 28.107995987 73.273979187 TYRC 71 ch -0.3800 414 HO 20.994127274 28.000011444 74.066841125 TYRC 71 ho 0.3500 415 CE 22.938613892 30.740638733 71.402084351 TYRC 71 c2 0.2000 416 HB1 22.321226120 31.65279960671.283157349 TYRC 71 h 0.1000 417 HB2 23.363500595 30.553305817 72.420455933 TYRC 71 h 0.1000 418 CG 24.110603333 30.760416031 70.402580261 TYRC 71 cp 0.000 419 CD1 23.933057785 31.274461746 69.111869512 TYRC 71 cp -0.1000 420 HD1 22.97762298631.679259164 68.509974670 TYRC 71 h 0.1000 421 CE1 24.985538483 31.264329910 68.201301575 TYRC 71 cp -0.1000 422 HE1 24.833002090 31.650396347 67.203536987 TYRC 71 h 0.1000 423 CZ 26.227394104 30.757091522 68.577156584 TYRC 71 cp 0.0300 424 OH27.265548160 30.762763977 67.686424255 TYRC 71 oh -0.3800 425 HN 29.966634750 31.154350798 66.863937378 TYRC 71 ho 0.3500 426 CE2 26.415199280 30.251981735 69.859985352 TYRC 71 cp -0.1000 427 HE2 27.377700806 29.852491379 70.147377014 TYRC 71 h 0.1000 428 CD2 25.360828400 30.253871918 70.770927429 TYRC 71 cp -0.1000 429 HD2 25.521846771 29.846044540 71.760574341 TYRC 71 h 0.1000 430 *The numbering of the amino acids is shifted by minus 6 relative to the sequence SEQ ID No. 1

SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 8 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 476 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii)MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 Leu Gln Pro Gly Ala Glu Val Pro Val Val Trp Ala Gln Glu Gly Ala 1 5 10 15 Pro Ala Gln Leu Pro Cys Ser Pro Thr Ile Pro Leu Gln Asp Leu Ser 20 25 30 Leu Leu Arg Arg Ala Gly Val Thr TrpGln His Gln Pro Asp Ser Gly 35 40 45 Pro Pro Ala Ala Ala Pro Gly His Pro Leu Ala Pro Gly Pro His Pro 50 55 60 Ala Ala Pro Ser Ser Trp Gly Pro Arg Pro Arg Arg Tyr Thr Val Leu 65 70 75 80 Ser Val Gly Pro Gly Gly Leu Arg Ser Gly Arg Leu Pro Leu GlnPro 85 90 95 Arg Val Gln Leu Asp Glu Arg Gly Arg Gln Arg Gly Asp Phe Ser Leu 100 105 110 Trp Leu Arg Pro Ala Arg Arg Ala Asp Ala Gly Glu Tyr Arg Ala Ala 115 120 125 Val His Leu Arg Asp Arg Ala Leu Ser Cys Arg Leu Arg Leu Arg Leu 130 135 140 GlyGln Ala Ser Met Thr Ala Ser Pro Pro Gly Ser Leu Arg Ala Ser 145 150 155 160 Asp Trp Val Ile Leu Asn Cys Ser Phe Ser Arg Pro Asp Arg Pro Ala 165 170 175 Ser Val His Trp Phe Arg Asn Arg Gly Gln Gly Arg Val Pro Val Arg 180 185 190 Glu Ser Pro His HisHis Leu Ala Glu Ser Phe Leu Phe Leu Pro Gln 195 200 205 Val Ser Pro Met Asp Ser Gly Pro Trp Gly Cys Ile Leu Thr Tyr Arg 210 215 220 Asp Gly Phe Asn Val Ser Ile Met Tyr Asn Leu Thr Val Leu Gly Leu 225 230 235 240 Glu Pro Pro Thr Pro Leu Thr Val TyrAla Gly Ala Gly Ser Arg Val 245 250 255 Gly Leu Pro Cys Arg Leu Pro Ala Gly Val Gly Thr Arg Ser Phe Leu 260 265 270 Thr Ala Lys Trp Thr Pro Pro Gly Gly Gly Pro Asp Leu Leu Val Thr 275 280 285 Gly Asp Asn Gly Asp Phe Thr Leu Arg Leu Glu Asp Val SerGln Ala 290 295 300 Gln Ala Gly Thr Tyr Thr Cys His Ile His Leu Gln Glu Gln Gln Leu 305 310 315 320 Asn Ala Thr Val Thr Leu Ala Ile Ile Thr Val Thr Pro Lys Ser Phe 325 330 335 Gly Ser Pro Gly Ser Leu Gly Lys Leu Leu Cys Glu Val Thr Pro Val 340 345350 Ser Gly Gln Glu Arg Phe Val Trp Ser Ser Leu Asp Thr Pro Ser Gln 355 360 365 Arg Ser Phe Ser Gly Pro Trp Leu Glu Ala Gln Glu Ala Gln Leu Leu 370 375 380 Ser Gln Pro Trp Gln Cys Gln Leu Tyr Gln Gly Glu Arg Leu Leu Gly 385 390 395 400 Ala Ala ValTyr Phe Thr Glu Leu Ser Ser Pro Gly Ala Gln Arg Ser 405 410 415 Gly Arg Ala Pro Gly Ala Leu Pro Ala Gly His Leu Leu Leu Phe Leu 420 425 430 Thr Leu Gly Val Leu Ser Leu Leu Leu Leu Val Thr Gly Ala Phe Gly 435 440 445 Phe His Leu Trp Arg Arg Gln TrpArg Pro Arg Arg Phe Ser Ala Leu 450 455 460 Glu Gln Gly Ile His Pro Arg Arg Leu Arg Ala Arg 465 470 475 (2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D)TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2 GCGCCTCGAG GCCCAGACCA TAGGAGAGAT GT 32 (2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C)STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 GCGCAGATCT CTCCAGACCC AGAACAGTGA GGTTATACAT 40 (2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4 GCGCAGATCT ACCTGGGCTA GACAGCTCTG TGAA 34 (2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A)LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 CGCCGTCGAC CGCTGCCCAG ACCATAGGAG AGATGTG 37 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCECHARACTERISTICS: (A) LENGTH: 37 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6 GCGCGTCGAC TTACATCGAG GCCTGGCCCA GGCGCAG 37 (2) INFORMATION FOR SEQID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7 GCGCGTCGAC TTAACCCAGA ACAGTGAGGT TATAC 35 (2)INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 GCGCGTCGAC TTAACCTGGGCTAGACAGCT CTGTG 35

* * * * *
 
 
  Recently Added Patents
Flash suppressor
Semiconductor memory device and method for erasing the same
Syncope logbook and method of using same
Device for sanitary removal of canine fecal matter and method therefor
Semiconductor display device
Cleaning and/or treatment compositions
Exhaust aftertreatment system with transmission control
  Randomly Featured Patents
Plane film cassette
Package of convenience food
Compact disc security package
Absorbent article
Lamp
Animal arena surface amendment
Air separating method using external cold source
Electrical connector with multifunction lock means
Regenerated cellulose containing cross linked sodium lignate or sodium lignosulfonate
Exterior antimigration refinements for self-cleaning indwelling therapeutic articles