| |
 |
Polypeptides with starch debranching activity |
| 8021863 |
Polypeptides with starch debranching activity
|
|
| Patent Drawings: |
(16 images) |
|
| Inventor: |
Viksoe-Nielsen, et al. |
| Date Issued: |
September 20, 2011 |
| Application: |
12/032,376 |
| Filed: |
February 15, 2008 |
| Inventors: |
Viksoe-Nielsen; Anders (Slangerup, DK) Fukuyama; Shiro (Chiba, JP) Behr; Regine Kopp (Roseville, CA) Andersen; Carsten (Vaerloese, DK)
|
| Assignee: |
Novozymes A/S (Bagsvaerd, DE) |
| Primary Examiner: |
Saidha; Tekchand |
| Assistant Examiner: |
Meah; Younus |
| Attorney Or Agent: |
Lambiris; Elias |
| U.S. Class: |
435/102; 435/183; 435/72 |
| Field Of Search: |
|
| International Class: |
C12P 19/10; C12P 19/00; C12N 9/00; C12N 9/26 |
| U.S Patent Documents: |
|
| Foreign Patent Documents: |
1200552; WO 98/16633; WO 00/01796; WO 2005/003311; WO 2005/045018; WO 2005/096804; WO 2006/066596 |
| Other References: |
Van Bueren et al., "x-Glucan recognition by a new family of carbohydrate-binding modules found primarily in bacterial pathogens",Biochemistry, vol. 43, pp. 15633-15642 (2004). cited by other. N. Sauvonet et al., "Extracellular secretion of pullulanase is unaffected by minor sequence changes but is usually prevented by adding reporter proteins to its n- or c-terminal end", Journal of Bacteriology, vol. 177, No. 18, pp. 5238-5246 (1995).cited by other. Boraston et al., "Carbohydrate-binding modules: fine-tuning polysaccharide recognition", Biochem. J., vol. 382, pp. 769-781 (2004). cited by other. Kelly et al., "Molecular genetic analysis of the pullulanase B gene of Bacillus acidopullulyticus", FEMS Microbiology Letters, vol. 115, pp. 97-106 (1994). cited by other. |
|
| Abstract: |
Polypeptides comprising a catalytic starch debranching domain and a starch binding domain are disclosed. The polypeptides comprising the starch binding domain have an improved functionality in raw starch degradation compared with same catalytic unit in same amount but without the starch binding domain. |
| Claim: |
The invention claimed is:
1. An isolated polypeptide having pullulanase activity, comprising a catalytic domain and a starch binding domain, wherein the catalytic domain comprises the sequenceof the amino acids numbered 1-829 of SEQ ID NO: 14.
2. The polypeptide of claim 1, wherein the starch binding domain belongs to a family selected from the group consisting of CBM-20, CBM-21, CBM-25, CBM-26, CBM-34, CBM-41 and CBM-45.
3. The polypeptide of claim 2, wherein the starch binding domain belongs to CBM-20.
4. The polypeptide of claim 3, wherein the starch binding domain is the starch binding domain of an Anoxybacillus contaminans alpha-amylase or the starch binding domain of a Thermoanaerobacter sp. CGTase.
5. The polypeptide of claim 1, wherein the starch binding domain comprises the sequence of the amino acids numbered 838-936 of SEQ ID NO: 14.
6. The polypeptide of claim 1, further comprising a linker connecting the catalytic domain and the starch binding domain.
7. The polypeptide of claim 6, wherein the linker consists of less than 100 amino acids.
8. The polypeptide of claim 7, wherein the linker is proline rich.
9. The polypeptide of claim 8, where the linker is PEPTPEPN.
10. A method for raw starch degradation comprising incubating non-gelatinized starch and water with the polypeptide of claim 1.
11. The method of claim 10 comprising: (a) providing a mixture comprising raw starch and water; (b) adding the polypeptide together with an endo-acting amylase or an exo-acting amylase; and (c) incubating the mixture at a temperature and fora time which are effective to degrade the starch.
12. The method of claim 11, wherein the exo-acting amylase is a glucoamylase.
13. An isolated polypeptide, comprising the amino acid sequence of SEQ ID NO: 13.
14. A method for raw starch degradation comprising incubating non-gelatinized starch and water with the polypeptide of claim 13.
15. The method of claim 14 comprising: (a) providing a mixture comprising raw starch and water; (b) adding the polypeptide together with an endo-acting amylase or an exo-acting amylase; and (c) incubating the mixture at a temperature and fora time which are effective to degrade the starch.
16. The method of claim 15, wherein the exo-acting amylase is a glucoamylase. |
| Description: |
FIELD OF THE INVENTION
The invention relates to polypeptides with starch debranching activity and to their use in starch hydrolysis, in particular in raw starch hydrolysis.
BACKGROUND FOR THE INVENTION
Starch is a natural storage carbohydrate found in a large variety of plants. Starch containing crops are important agricultural crops in almost every part of the world. Among the most important crops containing starch can be mentioned corn,wheat, rice, barley and potatoes.
Enzymatic degradation of starch is part of many industrial processes including brewing, production of glucose or high fructose syrups and production of drinking or fuel ethanol.
In its natural state starch is quite resistant against degradation by many enzymes, and therefore industrial enzymatic degradation of starch is traditionally initiated by a heating step where starch is gelatinized, which renders the starch moresensitive to many enzymes. Gelatinization leads to a high increase in viscosity which may give technical difficulties but is usually necessary in order to obtain a satisfactory high degree of degradation.
A combination of endo-acting enzymes, e.g. .alpha.-amylase; exo-acting enzymes, e.g. .beta.-amylase and glucoamylase; and debranching enzymes; e.g. pullulanases and iso-amylases are used for enzymatic degradation of starch.
WO 98/16633 describes hybrids comprising a starch degrading enzyme, a carbohydrate binding domain (CBD) and a linker. Pullulanase is mentioned as an example of a starch degrading enzyme. The only exemplified hybrid consists of an alpha-amylasea CBD and a linker.
EP 1200552 B1 discloses the expression in plants of starch altering proteins, e.g. pullulanases, as hybrids with a starch binding domain (SBD). The hybrids have the benefit that they are localized to the starch granules in the plants andthereby altered starch is produced.
Van Bueren et al. Biochemistry 2004, 43: 15633-15642 describe a four module protein having pullulanase activity isolated from the hyperthermophile eubacteria Thermotoga maritima. One of the four modules of the protein was identifies as a newtype carbohydrate binding domain having highest affinity for alpha-(1-4) linked glucans.
N. Sauvonnet et al. 1995. J. Bact. 177 (18): 5238-5246, disclose a study relating to a bacterial pullulanase where it was found that minor insertions could be accepted, fusions of larger proteins to the N- or C-terminal could usually not besecreted efficiently.
WO 2005/096804 discloses polynucleotides for expression in plants. The polynucleotide may encode a fusion polypeptide comprising a first polypeptide and a second peptide. The first polypeptide may have pullulanase activity, and the secondpeptide may be an N-terminal signal sequence from a starch binding domain.
SUMMARY OF THE INVENTION
The inventors have found that by adding a starch binding domain (SBD) onto a starch debranching domain, it is possible to obtain a better raw starch hydrolysis.
Accordingly, the invention provides a fusion polypeptide (hybrid polypeptide) comprising a catalytic starch debranching domain, a starch binding domain (SBD) and optionally a linker connecting the domains. The catalytic starch debranchingdomain is preferably a pullulanase.
The invention also provides the preparation of the fusion polypeptide according to the invention. The invention further provides the use of a polypeptide comprising a catalytic starch debranching domain and a starch binding domain in starchdegradation, in particular raw starch degradation.
SHORT DESCRIPTION OF THE DRAWINGS
FIGS. 1-16 show the plasmids pKK223-3, pNBT51, pNBT52, pNBT53, pNBT54, pNBT35, pNBT30, pNBT31, pNBT36, pRB165, pMRT135, pWWi006, pMDT105, pMDT114, pMBin115 and pRB212. Details are given in the Examples.
DEFINITIONS
A domain of a polypeptide is according to the invention intended to mean a part of a polypeptide being structurally and/or functionally distinct of the reminder of the polypeptide. For example polypeptides are known having a catalytic domainresponsible for the catalytic properties of the polypeptide, while a second domain may be responsible for binding to a particular structural component. Natural polypeptides may consist of only one domain or may comprise two or more domains. Typicallyeach domain is capable of folding and functioning independently of the reminder of the polypeptide.
A catalytic domain may be a part of an enzyme or it may be the complete enzyme.
A starch debranching enzyme is according to the invention intended to mean an enzyme capable of catalyzing the debranching of starch.
Starch is a polymer composed of glucosyl residues connected via .alpha.-1,4 bonds. Generally starch is composed of amylose, a polymer consisting of glucosyl residues connected via .alpha.-1,4 linkages, and amylopectin also consisting ofglucosyl residues connected via .alpha.-1,4 linkages with branches of .alpha.-1,4 linked glucosyl chains connected to another .alpha.-1,4 linked glucosyl chains via an .alpha.-1,6 linkage. Debranching enzymes which can attack amylopectin includeisoamylases (E.C. 3.2.1.68) and pullulanases (E.C. 3.2.1.41). Isoamylases hydrolyses .alpha.-1,6-D-glucosidic branch linkages in amylopectin and .beta.-limit dextrins and can be distinguished from pullulanases by the inability of isoamylase to attackpullulan, and by their limited action on .alpha.-limit dextrins. The ratio of amylose to amylopectin, the frequency of branches on the amylopectin and the average chain length for the branches varies considerably depending on the source of the starchbut this is not considered important for the present invention. Thus a starch debranching enzyme is a polypeptide capable of catalyzing the degradation of the .alpha.-1,6 linkages in amylopectin and thereby removing branches from an amylopectinstructure.
In the present specification the term "starch debranching enzyme" or grammatically equivalent similar expressions are intended to mean an enzyme or protein domain having catalytic activity being capable of degrading an .alpha.-1,6-glucosidiclinkage connecting two glucose units. Thus the term includes but is not limited to enzymes described as pullulanases or iso-amylases.
The starch debranching enzyme may be a protein as found in nature, a fragment of a protein found in nature or it may be a variant of such a protein.
With the term variant is understood a protein directly or indirectly derived from a natural protein by at least one alteration, such as a substitution, insertion or deletion. Variants of a protein may be prepared using techniques well known tothe skilled person within molecular biology and described in established handbooks such as J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, N.Y.
A catalytic starch debranching domain is intended to mean a part of starch debranching enzyme, which part is responsible for the catalytic activity of the complete enzyme. Thus a catalytic starch debranching domain may the complete or a part ofa starch debranching enzyme.
Carbohydrate binding domains are protein structures capable of binding a carbohydrate, usually with non-covalent bindings. Carbohydrate binding domains includes domains binding polysaccharides such as cellulose, xylan or starch. Severalcarbohydrate binding domains have been described in the literature, and have been grouped in families, for review see Boraston et al. (2004) Biochem. J. 382: 769-781 and http://afmb.cnrs-mrs.fr/CAZY/index.html for the grouping of CBM families.
A starch binding domain is a carbohydrate binding domain having specificity for starch, in particular raw starch. Starch binding domains are found in at least the carbohydrate binding domain families CBM-20, CBM-21, CBM-25, CBM-26, CBM-34,CBM-41 and CBM-45.
A linker is a proteinaceous part separating the catalytic starch debranching domain from the carbohydrate binding domain without interfering with the activity of the two domains.
Starch degradation is in the present specification understood as the enzymatic depolymerization of starch forming dextrins and glucose. Starch degradation is usually performed using a combination of enzymes capable of hydrolyzing .alpha.-1,4and .alpha.-1,6 glucosidic bonds such as .alpha.-amylases, .beta.-amylases, glucoamylases, pullulanases, iso-amylases and CGTases. Usually starch degradation is performed using a combination of at least one endo-acting amylase, such as an.alpha.-amylase, and at least one exo-acting amylase, such as a .beta.-amylase or a glucoamylase, and optionally a debranching enzyme such as a pullulanase. Traditionally starch degradation is performed by heating a mixture of starch containing materialand water followed by the addition of the enzymes and holding the mixture at a suitable temperature until the degradation is completed or reached a desirable extend. During the initial heating of the mixture of starch containing material and water thestarch will gelatinize leading to a significant increase in the viscosity of the mixture.
Raw starch is in the present specification understood as non gelatinized starch. Raw starch degradation is a starch degradation process performed without starch gelatinization and the following substantial increase of viscosity.
DETAILED DESCRIPTION OF THE INVENTION
The invention provides a fusion polypeptide comprising a starch debranching catalytic domain and a starch binding domain and optionally a linker sequence connecting said domains.
Starch Debranching Catalytic Domain
The starch debranching catalytic domain may in principle be any such domain capable of catalyzing the debranching of starch. The starch debranching catalytic domain is preferably derived from a pullulanase.
Debranching enzymes have been described from several organisms mainly bacteria including species of the genus Bacillus and Pyrococcus; and plants including barley and rice. For the present invention it is preferred that the debranching enzymeis derived from a bacterium, such as a pullulanase derived from Bacillus acidopullulyticus, B. deramificans, Klebsiella pneumonia, K. aerogenes or Pyrococcus sp.; or an isoamylase derived from Rhodothermus marinus, Pseudomonas amytoderamosa, Pseudomonassp. SMP1, Flavobacterium odoratum, Sullolobus acidocaldarius or S. solfatarius.
Preferably is the debranching enzyme according to the invention a pullulanase derived from a bacterium, preferably from the genus Bacillus.
In a preferred embodiment the debranching enzyme is a pullulanase derived from B. acidopullulyticus, in particular pulB/C hybrid (fusion) consisting of residues 11-837 of SEQ ID NO: 14. It consists of the portion of the pulB gene upstream ofthe Bam HI site within the coding region (see Kelly et al., 1994 FEMS Microbiol. Letters, 115: 97-106; incorporated by reference) and the portion of the pulC gene of B. acidopullulyticus downstream of the Bam HI site within the coding region.
The debranching enzyme may be a natural enzyme or it may be a variant of a natural enzyme still having debranching activity. In this connection a variant is understood as a polypeptide differing from a natural polypeptide by at least one aminoacid residue. The at least one differing amino acid may be selected among substitutions, insertion or deletions of one or more amino acid residue or any combination thereof. Methods for preparing such variants are well known to the skilled person.
In one embodiment is the debranching enzyme a variant as disclosed in WO 00/01796 or WO 01/51620, both incorporated herein by reference.
Starch Binding Domain (SBD)
The starch binding domain (SBD) may in principle be any protein domain capable of binding to starch. Preferably the SBD is capable of binding to raw starch, which in this specification is understood as non gelatinized starch.
The SBD may belong to a recognized group of carbohydrate binding modules, or it may have a unique structure not being similar to other known carbohydrate binding modules.
Several carbohydrate binding modules (CBMs) have been described in the literature and grouped in families based on sequence and structural similarities. Starch binding domains are found in the carbohydrate binding domain families CBM-20,CBM-21, CBM-25, CBM-26, CBM-34, CBM-41 and CBM-45. It is preferred that the SBD according to the invention belongs to the CBM-20 family.
SBDs belonging to the CBM-20 family have been found in enzymes derived from archaebacteria such as in the PF1108 protein from Pyrococcus furiosus DSM 3638 (Uniprot acc. No. Q8U1U7); from eubacteria such as in the .alpha.-amylase protein derivedfrom Anoxybacillus contaminans (previously known as Bacillus flavothermus), the .alpha.-amylase from Bacillus licheniformis and the .alpha.-amylase from Bacillus circulans AM7; and from eukaryotes such as in the glucoamylase from Aspergillus niger.
According to the invention it is preferred that the SBD belonging to the CBM-20 family is preferably derived from a microorganism belonging to the genus, Bacillus, Geobacillus, Anoxybacillus, Pyrococcus or Aspergillus.
Two SBDs belonging to the CBM-20 family are shown in SEQ ID NO: 15 and as residues 838-936 of SEQ ID NO: 14. The former is derived from the Thermoanaerobacter sp. CGTase (Joergensen et al (1997) in Biotechnol. Lett. 19:1027-1031), and thelatter is derived from Anoxybacillus contaminans .alpha.-amylase (WO 2006/066596).
The SBD may be a natural SBD or it may be a variant of a natural SBD having starch binding activity. In this connection a variant is understood as a polypeptide differing from a natural polypeptide by at least one amino acid residue. The atleast one differing amino acid may be selected among substitutions, insertion or deletions of one or more amino acid residue or any combination thereof. Methods for preparing variant of a protein such as a SBD are well known to the skilled person.
Linker
An important purpose of the linker is separating the catalytic domain from the SBD in order to prevent any steric hindrance of the function of one domain of the fusion by another part of the fusion. The linker may consist of only one or a fewamino acids resulting of the construction strategy of the fusion, or the linker may be a longer peptide. In principle there is no upper length of the linker but for practically reasons A is preferred that the linker is not longer than approximately 100amino acid residues. Thus a preferred linker according to the invention is between 1 and 100 amino acids preferably between 2 and 50 amino acids, more preferred between 2 and 25 amino acids, and most preferred between 5 and 20 amino acids.
The exact sequence of the linker is not critical, however it is preferred that the sequence of the linker is selected so that the linker does not adopt any rigid structure. The amino acid composition of the linker is preferably selected so thatthe linker is rich in hydrophilic residues. Further proline residues may be beneficial since they have the ability to disrupt any secondary structure of the linker.
In one preferred embodiment is the linker a proline rich linker. In this connection is a proline rich linker intended to mean a linker where at least 20% of the residues are proline residues, preferably between 25 and 50% of the residues.
A preferred example of a proline rich linker according to the invention is -PEPTPEPN- (SEQ ID NO: 1).
In a particularly preferred embodiment, the fusion according to the invention consists of the mature part of SEQ ID NO: 14. It comprises a pulB/C hybrid (fusion) created by expression of a pulB/C gene hybrid (fusion) consisting of the portionof the pulB gene upstream of the BamHI site within the coding region (see Kelly et al., supra) and the portion of the pulC gene of B. acidopullulyticus downstream of the BamHI site within the coding region, the SBD derived from the A. contaminans.alpha.-amylase or the Thermoanaerobacter sp. CGTase, and the linker -PEPTPEPN- (SEQ ID NO: 1).
The fusions according to the invention are conveniently produced by providing nucleic acid encoding the fusion of the invention, inserting said nucleic acid into a suitable expression vector having a suitable promoter and suitable regulatorysequences adapted to the particular selected host cell, transforming a host cell with the expression vector, cultivating the transformed host cell in a suitable growth medium promoting the expression of the fusion and subsequently recovering the fusions. Techniques for expressing a recombinant polypeptide such as the fusions according to the invention, expression vectors, host cells etc. are abundantly available in the art and it is within the skills of the average practitioner to select suitableconditions for producing the fusions according to the invention e.g. using well known methods described in Sambrook et al. op. cit.
Recombinant Expression Vectors
In another aspect, the invention relates to a recombinant expression vector comprising nucleic acids encoding a fusion according to the invention.
The recombinant expression vector of the invention may be any expression vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector often depends on the host cell into which it is going to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extra-chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, whenintroduced into a host cell, is integrated into the host cell genome, in part or in its entirety, and replicated together with the chromosome(s) into which it has been integrated. The expression vector may be derived from plasmid or viral DNA, or maycontain elements of both.
In an expression vector of this invention, the DNA sequence encoding the fusion preferably is operably linked to additional segments required for transcription of the DNA, in particular one or more promoter and terminator regions. The term,"operably linked", indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the enzyme.
The promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
Examples of suitable promoters for use in bacterial host cells include the promoter of the Bacillus stearothermophilus maltogenic amylase gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus amyloliquefaciens alpha-amylase gene, theBacillus subtilis alkaline protease gene, or the Bacillus pumilus xylosidase gene, or the phage Lambda P.sub.R or P.sub.L promoters or the E. coli lac, trp or tac promoters.
The DNA sequence encoding the enzyme of the invention may also, if necessary, be operably connected to a suitable terminator.
The recombinant expression vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
The expression vector of the invention may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, or a gene encoding resistance to e.g. antibiotics like kanamycin, chloramphenicol,erythromycin, tetracycline, spectinomycin, or the like, or resistance to heavy metals or herbicides.
To direct the enzyme into the secretory pathway of the host cells, a secretory signal sequence (also known as a leader sequence, prepro sequence or pre sequence) may be provided in the recombinant vector. The secretory signal sequence is joinedto the DNA sequence encoding the enzyme in the correct reading frame. Secretory signal sequences are commonly positioned 5' to the DNA sequence encoding the enzyme. The secretory signal sequence may be that normally associated with the enzyme or may befrom a gene encoding another secreted protein.
The procedures used to ligate the DNA sequences coding for the present enzyme, the promoter and optionally the terminator and/or secretory signal sequence, respectively, or to assemble these sequences by suitable PCR amplification schemes, andto insert them into suitable vectors containing the information necessary for replication or integration, are well known to persons skilled in the art (cf. e.g. Sambrook et al., op. cit.).
Raw Starch Degradation
In a further aspect the invention relates to a method for degrading raw starch using a polypeptide comprising a catalytic starch debranching domain and a starch binding domain. The inventors have surprisingly realized that a more efficient rawstarch degradation can be achieved using a polypeptide comprising a catalytic starch debranching domain and a starch binding domain compared to using a polypeptide comprising same catalytic starch debranching domain but without the starch binding domain.
The polypeptide comprising a catalytic starch debranching domain and a starch binding domain may be a natural enzyme or it may be a fusion according to the invention. Preferably the polypeptide comprising a catalytic starch debranching domainand a starch binding domain is a fusion according to the invention, even more preferred a fusion polypeptide comprising a catalytic pullulanase domain and a starch binding domain.
Typically the method for degrading raw starch comprises the following steps: a) providing a mixture comprising raw starch and water; b) adding at least one polypeptide comprising a catalytic starch debranching domain and a starch binding domain,at least one endo acting amylase and at least one exo-acting amylase; c) incubating the mixture at a suitable temperature and for a sufficient time to obtain the desired degree of degradation.
The mixture in step a) may additionally comprise pH regulating compounds, inorganic salts etc. The raw starch may be any raw starch, but it is preferred that the starch is cereal starch such as starch from corn, wheat, barley, sorghum etc.
The polypeptide comprising a catalytic starch debranching domain and a starch binding domain may be a natural polypeptide or it may be a fusion according to the invention.
The endo acting amylase is preferably an .alpha.-amylase selected among .alpha.-amylases derived from a microbial source in particular from a filamentous fungus or a yeast, or a bacteria. Numerous .alpha.-amylases are known within the art andit is within the capabilities of the skilled person to select a suitable .alpha.-amylase for the method for raw starch degradation according to the invention. As examples of suitable .alpha.-amylases can be mentioned the .alpha.-amylase derived from astrain of Acremonium, a strain of Alcaligenes, in particular Alcaligenes latus, a strain of Aspergillus, in particular Aspergillus kawachii and Aspergillus oryzae, a strain of Bacillus, in particular Bacillus amyloliquefaciens, Bacillus licheniformis,Bacillus polymyxa, Bacillus subtilis and Bacillus stearothermophilus, a strain of Desulfurococcus, in particular Desulfurococcus mucosus, a strain of Fervidobacterium, a strain of Lactobacillus, a strain of Micrococcus, a strain of Pseudomonas, inparticular Pseudomonas amyloderamosa, a strain of Pyrococcus, in particular Pyrococcus furiosus and Pyrococcus woesei, a strain of Pyrodictium, a strain of Sulfolobus, a strain of Staphylothermus, or a strain of Thermococcus sp.
The exo-acting amylase is preferably a glucoamylase such as a glucoamylase derived from Aspergillus niger, A. awamori, A. kawachii, Talaromyces emersonii, Trametes cingulata or Athelia rolfsii.
The .alpha.-amylase and/or the glucoamylase may be (a) natural enzyme(s), or may be (a) variant enzyme(s) modified using well known recombinant DNA technology methods.
In one preferred embodiment is the raw starch degradation a part of process for preparing fuel ethanol.
Other uses contemplated by the inventors include the use of the fusion according to the invention in detergent compositions, starch liquefaction or saccharification or textile desizing.
The invention is not described further by the following examples which are provided for illustrative purposes and not should be considered limiting in any way.
Experimental
Media
Bacillus strains were grown on TBAB plates (Difco Tryptose Blood Agar Base (BD Diagnostics, Franklin Lakes, N.J., USA) or LB agar plates (10 g/l Tryptone, 5 g/l yeast extract, 5 g/l NaCl, 15 g/l bacto agar) or in VY liquid medium (25 g/l vealinfusion (BD Diagnostics, Franklin Lakes, N.J., USA), 5 g/l yeast extract). As necessary, filter sterilized antibiotics were added to media after autoclaving at the following concentrations: spectinomycin, 120 micro-g/ml; neomycin, 6 micro-g/ml;chloramphenicol, 5 micro-g/ml.
E. coli strains were grown on LB liquid medium (10 g/l Tryptone, 5 g/l yeast extract, 5 g/l NaCl) or LB agar (LB medium and 15 g/l bacto agar) or 2.times.YT agar (16 g/l of Tryptone, 10 g/l of yeast extract, 5 g/l of NaCl, 15 g/l bacto agar)supplemented with 100 micro-g/ml ampicillin (filter sterilized, added after autoclaving).
Bacillus Host Strains
Bacillus subtilis 168.DELTA.4 is derived from the Bacillus subtilis type strain 168 (BGSC 1A1, Bacillus Genetic Stock Center, Columbus, Ohio) and has deletions in the spolIAC, aprE, nprE, and amyE genes. The deletion of these four genes wasperformed essentially as described for Bacillus subtilis A164.DELTA.5, which is described in detail in U.S. Pat. No. 5,891,701.
B. subtilis A164.DELTA.10 is strain A164.DELTA.5 with deletions in the minor extracellular protease genes wprA, bpr, vpr, mpr, and epr (Connelly et al., 2004, J. Bacteriol. 186: 4159-4167).
Plasmid and Genomic DNA Isolations
Plasmid DNA was isolated from E. coli transformants using a QIAprep 8 Miniprep Kit (QIAGEN, Valencia, Calif., USA) or using a BioRobot 9600 (QIAGEN Inc., Valencia, Calif., USA), or using a QIAGEN Plasmid Midi Kit (QIAGEN Inc., Valencia, Calif.,USA) according to the procedure provided by the respective manufacturers.
Genomic DNA was isolated from Bacillus subtilis hosts according to the procedure of Pitcher et al., 1989, Lett. Appl. Microbiol. 8: 151-156.
Transformation Methods for E. coli and B. subtilis
B. subtilis strains were transformed according to the procedure of Anagnostopolous and Spizizen (J. Bacteriol. 81: 741-746).
E. coli SURE cells (Stratagene Corporation, La Jolla, Calif., USA), DH5.alpha. cells (Gibco BRL, Gaithersburg, Md., USA), and One Shot.RTM. TOP10 cells (Invitrogen, Carlsbad, Calif., USA), XL1-Blue cells (Stratagene Corporation, La Jolla,Calif., USA) were transformed according to the procedure provided by the respective manufacturers.
PCR
The PCRs were performed according to the manufacturer's instructions described above. The amplification reactions (50 micro-L) were composed of 1.times.PCR Buffer II (Applied Biosystems, Foster City, Calif., USA), 3.0 mM MgCl.sub.2, 200 micro-Mof each dNTP, 0.5 micro-M of each primer, 0.25 units of Taq DNA Polymerase, and approximately 50-100 ng of plasmid DNA or approximately 200 ng of genomic DNA. The reactions were performed in a RoboCycler.RTM. 40 Temperature Cycler (Stratagene, LaJolla, Calif., USA) programmed for 1 cycle at 95.degree. C. for 2 minutes; 30 cycles each at 95.degree. C., 55.degree. C., and 72.degree. C. for 2 minutes; and 1 cycle at 72.degree. C. for 3 minutes.
DNA Sequencing
DNA sequencing was performed using an Applied Biosystems Model 3130X Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA) using dye terminator chemistry (Giesecke et al., 1992, Journal of Virol. Methods 38: 47-60).
Pullulan-Azure and AZCL-Pullulan Overlays
Pullulanase activity of Bacillus strains on agar plates was detected using an agar overlay containing pullulan-azure (Sigma, St. Louis, Mo., USA) or AZCL-pullulan (Megazymes International Ireland Ltd., Bray, Ireland). A layer of 1% agar in 100mM sodium acetate (pH 5.0) containing 0.5% pullulan-azure or 0.1% AZCL-pullulan was poured over colonies on agar plates, which were then incubated at 50.degree. C. Pullulanase activity was detected by formation of a zone of clearing in thepullulan-azure surrounding a colony.
Enzyme Activities:
Glucoamylase Activity (AGU)
The Novo Glucoamylase Unit (AGU) is defined as the amount of enzyme, which hydrolyzes 1 micromole maltose per minute at 37.degree. C. and pH 4.3.
The activity is determined as AGU/ml by a method modified after (AEL-SM-0131, available on request from Novozymes) using the Glucose GOD-Perid kit from Boehringer Mannheim, 124036. Standard: AMG-standard, batch 7-1195, 195 AGU/ml. 375 micro-Lsubstrate (1% maltose in 50 mM Sodium acetate, pH 4.3) is incubated 5 minutes at 37.degree. C. 25 micro-L enzyme diluted in sodium acetate is added. The reaction is stopped after 10 minutes by adding 100 micro-L 0.25 M NaOH. 20 micro-L is transferredto a 96 well microtiter plate and 200 micro-L GOD-Perid solution (124036, Boehringer Mannheim) is added. After 30 minutes at room temperature, the absorbance is measured at 650 nm and the activity calculated in AGU/ml from the AMG-standard. A folder(AEL-SM-0131) describing this analytical method in more detail is available on request from Novozymes A/S, Denmark, which folder is hereby included by reference.
Pullulanase Activity (New Pullulanase Unit Novo. NPUN)
Pullulanase activity may be determined relative to a pullulan substrate. Pullulan is a linear D-glucose polymer consisting essentially of maltotriosyl units joined by 1,6-alpha-links. Endo-pullulanases hydrolyze the 1,6-alpha-links at random,releasing maltotriose, 63-alpha-maltotriosylmaltotriose, 63-alpha-(63-alpha-maltotriosyl-maltotriosyl)-maltotriose.
One new Pullulanase Unit Novo (NPUN) is a unit of endo-pullulanase activity and is measured relative to a Novozymes A/S Promozyme D standard. Standard conditions are 30 minutes reaction time at 40.degree. C. and pH 4.5; and with 0.7%Red-pullulan as substrate. The amount of red substrate degradation product is measured spectrophotometrically at 510 nm and is proportional to the endo-pullulanase activity in the sample. A folder (EB-SM.0420.02/01) describing this analytical method inmore detail is available upon request to Novozymes A/S, Denmark, which folder is hereby included by reference.
Under the standard conditions one NPUN is approximately equal to the amount of enzyme which liberates reducing carbohydrate with a reducing power equivalent to 2.86 micromole glucose per minute.
Media
TABLE-US-00001 SSB-4: Sucrose/Soy/Biotin Agar Media component Amount Soy peptone 10 g/L Sucrose 10 g/L Na.sub.3-citrate-2H.sub.2O 2 g/L KH.sub.2PO.sub.4 4 g/L Na.sub.2HPO.sub.4 5 g/L 0.15 mg/mL Biotin 1 mL/L Ms-2 (Mikrosoy) 6 mL/L Bacto Agar 15g/L
TABLE-US-00002 PRK50 shake flask media Media component Amount Soybean meal 110 g/L Na.sub.2HPO.sub.4 5 g/L SB2121 (antifoam) 1 mL/L Adjust to pH 7 with NaOH
TABLE-US-00003 DK Pullulanase media Media component Amount J6 Hydrolysate 490 g/L K.sub.2SO.sub.4 6 g/L Na.sub.2HPO.sub.4 5 g/L K.sub.2HPO.sub.4 12 g/L SB2121 1.25 mL/L (NH.sub.4).sub.2SO.sub.4 4 g/L CaCO.sub.3 0.34 g/L Citric acid 2 g/LMgSO.sub.4.cndot.7H.sub.2O 4 g/L Sporemetal premix (from DK pilot) 40 mL/L 0.3 mg/mL biotin stock solution 2 mL/L
TABLE-US-00004 Sucrose Feed Media component Amount Sucrose 708 g/L SB2121 4 mL/L
J6: Tubermine Potato Protein Hydrolysate
To make 10 L, add 5 L tap water and 0.75 kg Tubermine to 12 L fermentor
Add water to 8 L, agitate for full suspension (500 rpm)
Start heating to 55.degree. C.
At 55.degree. C., add 4N NaOH to pH 7.00 At pH=6.20 viscosity will increase At pH=7.00, add 72.9 g Alcalase 2.4 4 HR hydrolysis Fill with water to 9 L At 5 HRs total, reduce agitation to 300 rpm Stop titration Add water to 10 L
EXAMPLES
Example 1
Construction of pNBT36
pNBT36 is pDG268MCS.DELTA.-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV with fragments of the Bacillus subtilis amy E gene, permitting insertion of the expression cassette at the amy E locus of the Bacillus subtilis chromosome by doublehomologous recombination via the two amy E fragments using chloramphenicol selection. The construction of pNBT36 is described below.
Plasmid pNBT51. Plasmid pNBT10 (pDG268MCS-Pr.sub.cryIIIA/cryIIIAstab/SAV; U.S. Pat. No. 6,255,076) was isolated from E. coli host DH5.alpha. according to the manufacturer's instructions, and digested with Cla I and Sca I. The Cla I ends wereblunted using Kienow fragment (New England Biolabs, Inc., Beverly, Mass., USA) and dNTPs according to the manufacturer's instructions. The digested plasmid was analyzed by 0.8% agarose electrophoresis with TBE (50 mM Tris base-50 mM boric acid-1 mMdisodium EDTA) buffer, and a vector fragment of approximately 6615 bp was purified using a QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, Calif., USA). Plasmid pOS4301 (Bacillus Genetic Stock Center, Ohio State University, Columbus, Ohio, USA) wasdigested with Sal I and Sca I, and the Sal I ends were blunted using Klenow fragment and dNTPs, as described above. The digested plasmid was analyzed by 0.8% agarose electrophoresis with TBE buffer, and a fragment of approximately 840 bp bearing the E.coli rmB transcription terminator was purified using a QIAquick Gel Extraction Kit. The same 840 bp Sal I/Sca I fragment could be isolated from the vector pKK223-3 (GE Healthcare, Piscataway, N.J., USA) (FIG. 1). The pNBT10 vector fragment andterminator-bearing fragment were ligated together with T4 DNA ligase (Roche Diagnostics Corporation, Indianapolis, Ind., USA) according to the manufacturer's instructions, and E coli DH5.alpha. was transformed with the ligation according to themanufacturer's instructions, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. The resulting plasmid was designated pNBT51 (pDG268-P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.) (FIG. 2).
Plasmid pNBT52. Plasmid pNBT51 (pDG268-P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.) was digested with Sfl I, and the ends were blunted by incubation for 20 minutes at 11.degree. C. with T4 DNA polymerase (Roche Diagnostics Corporation, Indianapolis,Ind., USA) and 25 micro-M of each dNTP, followed by heat-inactivation of the polymerase by incubation for 10 minutes at 75.degree. C. The blunt-ended plasmid was then digested with Dra III and analyzed by 0.8% agarose electrophoresis with TBE buffer,and a vector fragment of approximately 5920 bp was purified using a QIAquick Gel Extraction Kit. Plasmid pNBT20 (pDG268MCS-P.sub.amyQ(sc)/SAV; U.S. Pat. No. 6,255,076) was digested with Dra III and Ecl 136II, and a fragment of approximately 1641 bpbearing a short consensus amyQ promoter (P.sub.amyQ(sc)) was purified using a QIAquick Gel Extraction Kit. The pNBT51 vector fragment and P.sub.amyQ(sc) fragment were ligated as described above, and E. coli DH5.alpha. was transformed with the ligationas described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digested with Sph I, and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmidwith expected restriction fragments of approximately 4873 bp and 2688 bp was designated pNBT52 (pDG268-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.) (FIG. 3).
Plasmid pNBT53. Plasmid pNBT6 (pHP13amp-SAV; U.S. Pat. No. 6,255,076) was digested with Sfi I and Sac I and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 6438 bp was purified using a QIAquickGel Extraction Kit. Plasmid pNBT52 (pDG268-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV.DELTA.) was digested with Sfi I and Sac I and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a fragment of approximately 727 bp bearing theP.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab tandem promoter was purified using a QIAquick Gel Extraction Kit. The pNBT6 vector fragment and P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab fragment were ligated as described above, and E coli DH5.alpha. cells weretransformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digested with Pvu II, and analyzed by 0.8% agaroseelectrophoresis using TBE buffer. One plasmid with expected restriction fragments of approximately 4903 bp, 1320 bp, and 942 bp was designated pNBT53 (pHP13amp-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 4).
Plasmid pNBT54. Plasmid pNBT1 (pDG268MCS; U.S. Pat. No. 6,255,076) was digested with Sfi I and Bam HI and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 6040 bp was purified using a QIAquickGel Extraction Kit. Plasmid pNBT53 (pHP13amp-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) was digested with Sfi I and Bam HI and analyzed by 0.8% agarose electrophoresis using TBE buffer, and a fragment of approximately 1953 bp bearing theP.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV cassette was purified using a QIAquick Gel Extraction Kit. The pNBT1 vector fragment and P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV fragment were ligated as described above, and E. coli DH5.alpha. cellswere transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants and analyzed by simultaneous digestion with Sfi I and Bam HIfollowed by 0.8% agarose gel electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 6040 bp and 1953 bp was designated pNBT54 (pDG268MCS-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 5).
Plasmid pNBT35. Plasmid pNBT2 (pDG268MCS.DELTA.-Pr.sub.cryIIIA/cryIIIAstab/SAV; U.S. Pat. No. 6,255,076) was digested with Sfi I and Bam HI and analyzed by 0.8% agarose gel electrophoresis with TBE buffer, and a vector fragment ofapproximately 5394 bp was purified using a QIAquick Gel Extraction Kit. Plasmid pNBT54 (pDG268MCS-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) was digested with Sfi I and Bam HI, and analyzed by 0.8% agarose gel electrophoresis with TBE buffer, and afragment of approximately 1953 bp bearing the P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV cassette was purified using a QIAquick Gel Extraction Kit. The pNBT2 vector fragment and P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV fragment were ligated asdescribed above, and E. coli DH5.alpha. cells were transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digested withNco I, and analyzed by 0.8% agarose gel electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 5492 bp and 1855 bp was designated pNBT35 (pDG268MCS.DELTA.-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 6).
Plasmid pNBT30. Plasmid pNBT30 was constructed to contain a PCR clone of the amyL4199 variant of the amyL gene promoter (U.S. Pat. No. 6,100,063). Bacillus licheniformis SJ1904 genomic DNA was isolated. The amyL4199 promoter(P.sub.amyL4199) gene was amplified by PCR from Bacillus licheniformis SJ1904 genomic DNA using primers 950872 and 991151 (SEQ ID NO: 2 and 3). Primer 950872 incorporates an Sfi I restriction site, and primer 991151 incorporates a Sac I restriction siteand the variant nucleotides of P.sub.amyL4199.
The PCR was performed according to manufacturer's recommendations described above. The resulting PCR product of approximately 625 bp was cloned into vector pCR2.1 using a TOPO TA Cloning.RTM. Kit (Invitrogen, Carlsbad, Calif., USA) andtransformed into One Shot.RTM. TOP10 Chemically Competent E. coli cells according to the manufacturer's instructions. Plasmid DNA was isolated from several transformants and analyzed for the presence of the cloned PCR fragment by digestion with Eco RIfollowed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 3913 bp and 640 bp was designated pNBT30 (pCR2.1-amyL4199) (FIG. 7). The DNA sequence of the cloned PCR fragment was confirmed byDNA sequencing.
Plasmid pNBT31. Plasmid pNBT3 (pDG268MCS.DELTA.neo-Pr.sub.cryIIIA/cryIIIAstab/SAV; U.S. Pat. No. 6,255,076) was digested with Sfi I and Sac I and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately7931 bp was purified using a QIAquick Gel Extraction Kit. Plasmid pNBT30 (pCR2.1-amyL4199) was digested with Sfi I and Sac I, analyzed by 0.8% agarose electrophoresis with TBE buffer, and a fragment of approximately 612 bp bearing P.sub.amyL4199 waspurified using a QIAquick Gel Extraction Kit. The pNBT3 vector fragment and P.sub.amyL4199 fragment were ligated as described above, and E. coli XL1-Blue cells were transformed with the ligation according to the manufacturer's instructions, selectingfor ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digested with Nco I, and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restrictionfragments of approximately 6802 bp and 1741 bp was designated pNBT31 (pDG268MCS.DELTA.neo-P.sub.amyL4199/Pr.sub.cryIIIA/cryIIIAstab/SAV) (FIG. 8).
Plasmid pNBT36. Plasmid pNBT35 (pDG268MCS.DELTA.-P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab/SAV) was digested with Sfi I, and the ends were blunted using T4 DNA polymerase and dNTPs, as described above. The blunt ended plasmid was then digestedwith Dra III, and analyzed by 0.8% agarose electrophoresis with TBE buffer. A vector fragment of approximately 5808 bp was purified using a QIAquick Gel Extraction Kit. Plasmid pNBT31 (pDG268MCS.DELTA.neo-P.sub.amyL4199/Pr.sub.cryIIIA/cryIIIAstab/SAV)was digested with Dra III and Ecl 136II, analyzed by 0.8% agarose electrophoresis with TBE buffer, and a fragment of approximately 2150 bp bearing P.sub.amyL4199 was purified using a QIAquick Gel Extraction Kit. The pNBT35 vector fragment andP.sub.amyL4199 fragment were ligated as described above, and E. coli SURE cells were transformed with the ligation according to the manufacturer's instructions, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. PlasmidDNA was isolated from several transformants, digested with Nco I, and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 5492 bp and 2466 bp was designated pNBT36(pDG268MCS.DELTA.-P.sub.amyL4199/P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab- /SAV) (FIG. 9). The promoter P.sub.amyL4199/P.sub.amyQ(sc)/P.sub.cryIIIA/cryIIIAstab will henceforth be referred to as triple tandem promoter.
Example 2
Construction of pRB165
Plasmid pRB165 is plasmid pRB162 (pDG268MCS-P.sub.amyQ(sc) with fragments of the Bacillus subtilis pectate lyase (per) gene, permitting insertion of the expression cassette at the pel locus of the Bacillus subtilis chromosome by doublehomologous recombination via the two pel fragments. U.S. Patent Application publication No. 20030175902) constructed to contain a PCR clone of the spectinomycin resistance gene as described below.
Plasmid pCR2.1-spc. The spectinomycin resistance gene was amplified by PCR from plasmid pSJ5218 (U.S. Pat. No. 6,808,896) DNA using primers 994079 and 994103 (SEQ ID NO: 4 and 5). Primer 994079 incorporates a Sal I restriction site, andprimer 994103 incorporates a Sfi I restriction site.
The PCR was performed according to manufacturer's recommendations described above. The PCR was performed in a RoboCycler.RTM. 40 Temperature Cycler as described above.
The resulting PCR product of approximately 1165 bp was cloned into vector pCR2.1 using a TOPO TA Cloning.RTM. Kit and transformed into One Shot.RTM. TOP10 Chemically Competent E. coli cells according to the manufacturer's instructions. Plasmid DNA was isolated from several transformants and analyzed for the presence of the cloned PCR fragment by digestion with Eco RI followed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments ofapproximately 3913 bp and 1183 bp was designated pCR2.1-spc. The DNA sequence of the spectinomycin gene was confirmed by DNA sequencing.
Plasmid pRB165. Plasmid pRB162 (pDG268MCS-P.sub.amyQ(sc) with pel 3' and pel 5') was digested with Sfi I and Sal I analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 4541 bp was purified using aQIAquick Gel Extraction Kit. Plasmid pCR2.1/spc was digested with Sfi I and Sal I, and a fragment of approximately 1153 bp bearing the spc gene was purified using a QIAquick Gel Extraction Kit. The pRB162 vector fragment and the spc gene fragment wereligated as described above, and E. coli SURE cells were transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digestedwith Bam HI and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 1329 bp and 4365 bp was designated pRB165 (pDG268MCS-P.sub.amyQ(sc) with pel 3', pel 5', and spc) (FIG. 10).
Example 3
Construction of pMRT135
Plasmid pMRT135. Plasmid pNBT36 (pDG268.DELTA.-PamyL4199/PamyQ(sc)/PcryIIIA/cryIIIAstab/SAV) was digested with Sfi I and Sac I and a fragment of approximately 1337 bp bearing the triple tandem promoter was purified using a QIAquick GelExtraction Kit. Plasmid pRB165 (pDG268.DELTA.neo-PamyQ(sc) with pel 3', pel 5', and spc) was digested with Sfi I and Sac I, analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 5591 bp was purified using aQIAquick Gel Extraction Kit. The pRB165 vector fragment and triple tandem promoter fragment were ligated as described above, and E. coli SURE cells were transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YTampicillin plates at 37.degree. C. Plasmid DNA was isolated from several transformants, digested with Sfi I and Sac I and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 5591 bpand 1337 bp was designated pMRT135 (pDG268.DELTA.neo-triple tandem promoter with pel 3', pel 5', and spc) (FIG. 11).
Example 4
Construction of pMDT105
Plasmid pMDT114. Plasmid pMDT114 (FIG. 14) consists of the approximately 5358 bp Sac I/Not I vector fragment of pMRT075 (US Patent Application publication No. 20050221446), the approximately 2622 bp Sac I/Mlu I fragment of pMDT105 (bearing theaprH ribosome binding site and pulB/C coding region), and the approximately 70 bp MluI/NotI fragment of pWWi006 (bearing the aprH transcription terminator). The construction of the plasmids pMDT105 and pWWi006 is described below.
Plasmid pWWi006. pWWi006 was constructed by eliminating the Bam HI site of pNBT18 (pDG268MCS.DELTA.neo-cryIIIAstab/SAV; U.S. Pat. No. 5,955,310). Plasmid pNBT18 was digested with Bam HI, and the ends were blunted using T4 DNA polymeraseaccording to the manufacturer's instructions. The pNBT18 vector fragment was then self-ligated using T4 DNA ligase according to the manufacturer's instructions, and E coli DH5.alpha. was transformed with the ligation according to the manufacturersinstructions, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. The resulting plasmid was designated pWWi006 (FIG. 12).
Plasmid pMDT105. Plasmid pMDT105 comprises the aprH ribosome binding site and pulB/C coding region inserted in the pCR2.1 vector and was constructed as follows.
Bacillus subtilis PL2545 contains a chromosomally integrated copy of the pulB/C gene hybrid (fusion). The pulB/C gene comprises a portion of the pulB gene of Bacillus acidopullulyticus 294-16 (Kelly et al., supra) upstream of the BamHI sitewithin the coding region and a portion of the pulC gene of Bacillus acidopullulyticus 246-49 downstream of the BamHI site within the coding region.
An approximately 2624 bp fragment comprising the pulB/C ribosome binding site and coding region was amplified by PCR from genomic DNA of Bacillus subtilis PL2545 using primers 998542 and 998543 (SEQ ID NO: 6 and 7). Primer 998542 incorporates aSac I restriction site and the ribosome binding site of Bacillus clausii alkaline protease gene aprH and converts the native GTG start codon of pulB to an ATG codon. Primer 998543 incorporates an Mlu I restriction site.
The resulting PCR product of approximately 2624 bp was cloned into pCR2.1 using a TOPO TA Cloning.RTM. Kit and transformed into One Shot.RTM. TOP10 Chemically Competent E. coli cells according to the manufacturer's instructions. Plasmid DNAfrom several transformants was purified and the DNA sequence of the cloned PCR fragment was determined by DNA sequencing. Each sequenced plasmid had at least one sequence discrepancy relative to the expected sequence for pulB/C, due to incorporationerrors by Taq DNA polymerase. A plasmid with one nucleotide discrepancy within pulB/C was designated pMDT103. This discrepancy was correct as follows, using a fragment of the pulB gene.
An approximately 2624 bp fragment comprising the pulB ribosome binding site and coding region was amplified by PCR from genomic DNA of Bacillus subtilis DN1400 (Kelly et al., supra) using primers 998542 and 998543 shown above.
The PCR was performed according to the manufacturer's instructions as described above.
The resulting PCR product of approximately 2624 bp was cloned into pCR2.1 using a TOPO TA Cloning.RTM. Kit and transformed into One Shot.RTM. TOP10 Chemically Competent E. coli cells according to the manufacturer's instructions. Plasmid DNAfrom several transformants was purified and tested for the presence of the cloned PCR fragment by digestion with Eco RI followed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with Eco RI fragments of approximately 3913 bp and 2642 bp wasdesignated pMDT102.
Plasmid pMDT102 was digested with Bbr PI and Nsi I and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 4915 bp was purified using a QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, Calif.,USA). Plasmid pMDT103 was digested with Bbr PI and Nsi I and analyzed by 0.8% agarose electrophoresis with TBE buffer, and a fragment of approximately 1640 bp bearing a downstream portion of the pulB/C coding region was purified using a QIAquick GelExtraction Kit. The pMDT102 vector fragment and pulB/C fragment were ligated as described above, and E. coli XL1-Blue cells were transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at37.degree. C. Plasmid DNA was isolated from several transformants, digested with BbrPI and NsiI, and analyzed by 0.8% agarose electrophoresis with TBE buffer. One plasmid with expected restriction fragments of approximately 4915 bp and 1640 bp wasdesignated pMDT105 (FIG. 13).
Example 5
Construction of pMBin115
Plasmid pMBin115. Plasmid pMDT114 was digested with Sac I and Not I, analyzed by 0.8% agarose electrophoresis with TBE buffer and a fragment of approximately 2684 bp bearing the pulB/C gene was purified using a QIAquick Gel Extraction Kit. Plasmid pMRT135 (pDG268.DELTA.neo-triple tandem promoter with pet 3', pet 5', and spc) was digested with Sac I and Not I, analyzed by 0.8% agarose electrophoresis with TBE buffer, and a vector fragment of approximately 6909 bp was purified using aQIAquick Gel Extraction Kit. The pMRT135 vector fragment and pulB/C fragment were ligated as described above, and E coli SURE cells were transformed with the ligation as described above, selecting for ampicillin resistance on 2.times.YT ampicillinplates at 37.degree. C. Plasmid DNA was isolated from several transformants, and analyzed for presence of the pulB/C insert by 0.8% agarose electrophoresis with TBE buffer. One plasmid was designated pMBin115 (pDG268.DELTA.neo-triple tandempromoter/pulB/C with pel 3', pel 5', and spc) (FIG. 15).
Example 6
Construction of pRB212 for Cloning and Expression of the pulB/C-linker-AMY1048 CBM in B. subtilis
Plasmid pRB212 is an E. coli replicon containing the expression cassette comprising of the triple tandem promoter, aprH ribosome binding site, the Bacillus acidopullulyticus pullulanase (pulB/C) coding region, a proline rich linker (-PEPTPEPN-),the A. contaminans .alpha.-amylase CBM (AMY1048 CBM) (CBM20 family) and aprH terminator. This expression cassette and the spc gene are flanked on both sides by fragments of the Bacillus subtilis pectate lyase (pel) gene, permitting insertion of theexpression cassette and spc gene at the pel locus of the Bacillus subtilis chromosome by double homologous recombination via the two pel fragments. The construction of pRB212 is described below.
Plasmid pRB210. A SOE (Splicing by Overlap Extension) strategy was devised to introduce a proline rich linker (-PEPTPEPN-) and AMY1048 CBM downstream of pulB/C. This SOE strategy allows for removal of pulB/C's stop codon, and insertion of thelinker and AMY1048 CBM at the 3' end of pulB/C.
The Upstream Fragment:
The upstream fragment (3'-end of pulB/C) was PCR amplified from pMBin115 using primers that include an overhang homologous to the 5'-end of the downstream fragment. Primers 999448 and 060179 (SEQ ID NO: 8 and 9) were synthesized for polymerasechain reaction (PCR) amplification of a 571 bp upstream fragment. Nucleotides 1-10 of 060179 were added in order to complement the 5' end of the 060180 primer used to amplify the downstream fragment. These primers allow for the PCR amplification of the3' end of pulB/C, not including pulB/C's stop codon.
This PCR was performed under the conditions described above.
The Downstream Fragment:
The downstream fragment (A. contaminans AMY1048 CBM (CBM20 family)) was PCR amplified from the cloned gene of AMY 1048 (SEQ ID NO: 1 in WO 2006/066596A2) using primers which include the -PEPTPEPTN- (SEQ ID NO: 1) linker and overhang homologousto the 3'-end of pulB/C. Primers 060180 and 999451 (SEQ ID NO: 10 and 11) were synthesized for polymerase chain reaction (PCR) amplification of a 542 bp downstream fragment: Nucleotides 1-24 of 060180 were added in order to introduce the linker-PEPTPEPN- (SEQ ID NO: 1) and complement the 5' end of the 060179 primer used to amplify the upstream fragment. Nucleotides 1-10 of 060180 represent the region of overlap between the upstream and downstream fragments.
This PCR was performed under the conditions described above.
The Full-Length Fragment:
The full length fragment was PCR amplified using as templates the upstream and downstream fragments described above. This PCR was performed using the primer pair 999448/999451 under the conditions described above.
This SOE provided a 1103 bp fragment which contains 561 bp of 3'-pulB/C, a 24 bp linker, and 518 bp comprising of AMY1048 CBM and downstream sequence.
This resulting PCR product of approximately 1103 bp was gel purified and cloned into vector pCR2.1 using a TOPO.RTM. TA PCR Cloning Kit for Sequencing and transformed into One Shot.RTM. TOP10 Chemically Competent E. coli cells according to themanufacturer's instructions. Plasmid DNA was isolated from one transformant and confirmed by digestions with Eco RI followed by 0.8% agarose electrophoresis with TBE buffer, which yielded expected fragments of approximately 3931 bp and 1121 bp. The DNAsequence of the cloned PCR fragment was confirmed by DNA sequencing. This plasmid was designated pRB210. The complete DNA sequence 3'-pulB/C-linker-AMY1048 CBM cloned in pCR2.1 is shown in SEQ ID NO: 12.
Plasmid pRB212. Plasmid pRB210 (pCR2.1-3'-pulB/C-linker-AMY1048 CBM) was digested with BstxX II and Mlu I, analyzed by 0.8% agarose electrophoresis with TBE buffer and a fragment of approximately 402 bp, bearing the 3'-pulB/C-linker-AMY1048CBM, was purified using a QIAquick Gel Extraction Kit. Plasmid pMBin115 (pDG268.DELTA.neo-triple tandem promoter/pulB/C with pel 3', pel 5', and spc) was digested with BstxX II and Mlu I, analyzed by 0.8% agarose electrophoresis with TBE buffer, and avector fragment of approximately 9442 bp was purified using a QIAquick Gel Extraction Kit. The pMBin115 vector fragment and 3'-pulB/C-linker-AMY 1048 CBM fragment were ligated as described above, and E. coli SURE cells were transformed with the ligationas described above, selecting for ampicillin resistance on 2.times.YT ampicillin plates at 37.degree. C. Plasmid DNA was purified from several transformants using a QIAGEN robot according to the manufacturer's instructions and analyzed by Bam HIdigestion on a 0.8% agarose gel using 0.5.times.TBE buffer. A plasmid was identified which contained the desired fragments (4638 bp, 2954 bp, and 2322 bp) was designated pRB212 (FIG. 16). This cloning strategy placed the linker and AMY 1048 CBM betweenpulB/C and a stop codon followed by aprH terminator. The pulB/C-linker-AMY1048 CBM coding region in this plasmid was confirmed to be error-free by DNA sequencing.
Example 7
Cloning and Expression of the pulB/C-linker-AMY1048 CBM in B. subtilis
Strain RB272. Plasmid pRB212 was used to transform B. subtilis 168.DELTA.4 to spectinomycin resistance as described above. Integrants were screened for neomycin sensitivity, indicating double-crossover integration at the pel locus. Thepresence of the pulB/C expression cassette was confirmed by formation of clearing zones on a pullulan-azure overlay (and AZCL-pullulan overlay) as described above. One such integrant was designated RB268. Genomic DNA was isolated from Bacillus subtilisRB268.
Expression of pulB/C-linker-AMY 1048 CBM was effected in a protease-deficient host, A164.DELTA.10 in order to minimize the processing and degradation of extracellular proteins (e.g. pulC-linker-CBM). To do so, the triple tandempromoter-pulB/C-linker-AMY1048 CBM expression cassette was then transferred to B. subtilis production host A164.DELTA.10 by transformation of the host with RB268 genomic DNA to spectinomycin resistance. The presence of the pulB/C expression cassette wasconfirmed by formation of clearing zones on a pullulan-azure overlay (and AZCL-pullulan overlay) as described above. One such integrant was designated RB272, which contains the triple tandem promoter/pulB/C-linker-AMY1048 CBM expression cassetteinserted at the pel locus of A164.DELTA.10.
Control Strain RB265
The control strain RB265 is the A164.DELTA.10 Bacillus subtilis host containing the expression cassette comprising the triple tandem promoter, aprH ribosome binding site, pullulanase (pulB/C) coding region, and aprH terminator integrated insingle copy at the pel chromosomal locus.
pMBin115 was used to transform B. subtilis 168.DELTA.4 to spectinomycin resistance. Integrants were screened for neomycin sensitivity, indicating double-crossover integration at the pel locus. The presence of the pulB/C expression cassette wasconfirmed by formation of clearing zones on a pullulan-azure overlay (and AZCL-pullulan overlay) as described above. One such integrant was designated 168.DELTA.4::triple tandem promoter/pulB/C. Genomic DNA was isolated from Bacillus subtilis168.DELTA.4::triple tandem promoter/pulB/C.
The triple tandem promoter-pulB/C expression cassette was then transferred to B. subtilis production host A164.DELTA.10 (Connelly et al., supra) by transformation of the host with 168.DELTA.4::triple tandem promoter/pulB/C genomic DNA tospectinomycin resistance. The presence of the pulB/C expression cassette was confirmed by formation of clearing zones on a pullulan-azure overlay (and AZCL-pullulan overlay) as described above. The clearing zones produced by RB272 are slightly smallerthan the clearing zones produced by the control strain RB265 harboring pulB/C without the AMY1048 CBM.
One such integrant was designated RB265, which contains the triple tandem promoter/pulB/C expression cassette inserted at the pel locus of A164.DELTA.10.
Example 8
Fermentation for expression of pulB/C-linker-AMY 1048 CBM In B. subtilis A164.DELTA.10
The strains RB265 and RB272 were tested in laboratory-scale fermentation as described below.
Seed Propagation
Seeds were propagated on solid media and then transferred to shake flasks to make the final inocula. Strains were streaked from -80.degree. C. freezer stocks onto SSB-4 plates.
Following this, plates were incubated at 37.degree. C. for 20 hours and then transferred to another SSB-4 plate for an additional 20 hour incubation. They were then harvested with 5 mL of M9 buffer to create a bacterial suspension. This M9suspension was then read at 650 nm and inoculation volume into 100 mL PRK50 baffled shake flasks was determined using the formula v=0.1/Abs650. Shake flasks incubated for 20 hours at 37.degree. C. and 250 rpm.
Tanks containing DK Pullulanase media were inoculated by adding 100 mL of the appropriate shake flask culture to the tank for a total working volume of 1.0 L. Process control was achieved manually and through the use of FermWorks control anddata logging software (Jova Solutions, San Francisco, Calif., USA).
Tanks were fed according to the profile with a sucrose feed and 4N NH.sub.4OH/5M H.sub.3PO.sub.4 to control pH. Tanks were sparged with compressed air at a controlled rate using an electronic mass flow device. Agitation was standardizedthrough calibrated motor controllers manually adjusted throughout the fermentation. Temperature was controlled using a 10.degree. C. cold-finger and an electric heater probe.
Process control was monitored throughout the fermentation using the data logging feature on the FermWorks software package. These data were exported in the form of points taken every five minutes.
pH.sub.high was 6.8 at time 0, and 6.2 at time 20-24-48. pH.sub.low was 5.9 at time 0-20-24-48. The set point for the airp profile was kept at 2.25 L/m, and the set point for the temp profile was kept at 37. The set point for the RPM profilewas 700 at time 0 and 1500 at time 1-3-48. The set point for the feed profile was 4.5 g/m at time 0; 22.5 g/m at time 15; 22.58 g/m at time 30; and 10.8 g/m a<t time 60.
Sampling
Small samples for verification of online pH were taken at various times throughout the fermentation. Samples for storage/analysis were drawn from tanks at approximately 3, 24 and 48 hours. For assay analysis 200 micro-L of whole broth wasloaded into a 96-well plate and frozen at -20.degree. C. For future reference and the potential need to re-assay, 1 mL of whole broth was pipetted into each of two 1.7 mL Eppendorf tubes. These were stored at -20.degree. C. in the whole broth library. An additional set of tubes was reserved for protein gel electrophoresis.
Example 9
Automated Pullulanase Assay
This method is used in conjunction with a Beckman Coulter Biomek NX (Beckman Coulter, Fullerton Calif.). Culture supernatants were diluted appropriately in 0.1M sodium acetate buffer pH 5.0 (sample buffer). Pullulanase standard was dilutedusing 2-fold steps starting with a 2 NPUN/ml concentration and ending with a 0.031 NPUN/ml concentration in the sample buffer. A total of 75 .mu.l of each dilution including standard was transferred to a 96-well flat bottom plate (assay plate). Fortymicro-liters of a 2.5% Red-pullulan substrate (Megazymes International Ireland Ltd., Wicklow, Ireland) in sample buffer was added to each well. The assay plate was then incubated at 40.degree. C. for 10 minutes. Upon completion of the incubationperiod 190 .mu.l of ethanol (95% v/v) was added per well followed with an ambient incubation for 10 minutes. The assay was then centrifuged at 3,000 RPM for 10 minutes. One-hundred-fifty micro-liters of supernatant was then removed and placed in a new96-well flat bottom plate. An absorbance of 510 nm was then measured. Sample concentrations were determined by extrapolation from the generated standard curve.
Approximate pullulanase titers for RB272 and RB265 were estimated to be in the multi-gram per liter range.
Example 10
SDS-PAGE Analyses of RB272 and RB265 Fermentation Samples
In order to test the stability of the fusion, fermentation samples of RB265 and RB272 were ran on a 7.5% Tris-HCl SDS-PAGE (Bio-Rad Laboratories, CA, USA) according to the manufacturer's instructions. Such analysis showed that the major proteinproduct were of the expected size for mature PulB/C (.about.91.7 kDa) and for the fusion pulB/C-linker-AMY1048 CBM (.about.103 kDa). Such an analysis not only confirmed that the strain RB272 produces a stable fusion, but also confirmed the high yield ofsuch a fusion at 24 h.
Example 11
Conversion of Granular Wheat Starch into Glucose
This example illustrates the conversion of granular starch into glucose using a pullulanase with or without a CBM20 in combination with a glucoamylase.
Initially a slurry with 10% wheat starch was made by adding 10 gram wheat starch to 90 mL of 0.2 M Na-acetate pH 5.5 under continuous stirring.
The following enzymes were dosed at time point zero (Table 1).
TABLE-US-00005 TABLE 1 Enzyme dosing AMG Pullulanase Pullulanase + CBM dosage dosage dosage Treatment AGU/g DS NPUN/g DS NPUN/g DS AMG 0.2 AMG + Pullulanase 0.2 0.32 AMG + 0.2 0.32 Pullulanase + CBM
After addition of the enzymes, the starch slurries were incubated at 60.degree. C. At time point 25 and 50 hours aliquots were removed and the amount of glucose in solution was determined. The glucose content was determined by measuring thereducing ends relative to a glucose standard curve.
The results are shown in Table 2 below.
TABLE-US-00006 TABLE 2 Results obtained after 25 and 50 hours hydrolysis mg glucose released/mL Time AMG + AMG + (hours) AMG Pullulanase Pullulanase + CBM 25 39 54 66 50 43 57 67
Example 12
Conversion of Granular Corn Starch into Glucose
This example Illustrates the conversion of granular starch into glucose using a pullulanase with or without a CBM20 in combination with a glucoamylase.
Initially a slurry with 3.2% corn starch was made by adding 3.6 gram corn starch to 112 mL of 50 mM Na-acetate, 1 mM CaCl.sub.2 under continuous stirring. The pH was adjusted to 4.0 with acetic acid.
The following enzymes were dosed at time point zero (Table 3).
TABLE-US-00007 TABLE 3 Enzyme dosing AMG Pullulanase Pullulanase + CBM dosage dosage dosage Treatment AGU/g DS NPUN/g DS NPUN/g DS AMG 0.3 AMG + Pullulanase 0.3 10 AMG + 0.3 10 Pullulanase + CBM
After addition of the enzymes the starch slurries were placed in a water batch at 32.degree. C. At time point 21 and 45 hours aliquots were removed and the amount of glucose in the solutions was determined as described above.
The results obtained are shown in Table 4 below.
TABLE-US-00008 mg glucose released/mL Time AMG + AMG + (hours) AMG Pullulanase Pullulanase + CBM 21 3.39 3.84 4.24 45 5.39 5.84 6.25
>
Artificial SequenceSynthetic u Pro Thr Pro Glu Pro AsnNAArtificial SequencePrimer 2ccaggcctta agggccgcat gcgtccttct ttgtgct 37327DNAArtificial SequencePrimer 3gagctccttt caatgtgata catatga 27426DNAArtificial SequencePrimer 4gtcgaccgcg tataataaag aataat 2653ificial SequencePrimer 5ggcccttaaggcccactaat attaataaac 3Artificial SequencePrimer 6gagctctata aaaatgagga gggaaccgaa tgtccctaat acgttctagg 5Artificial SequencePrimer 7acgcgtttaa ttttgatcaa tgacatc 27838DNAArtificial SequencePrimer 8agcgcaagta atccgaacga tacacaagca gatcgaat38938DNAArtificial SequencePrimer 9tcggttccgg attttgatca atgacatctt cagatgta 38Artificial SequencePrimer accga ccccggaacc gaacacttcc caaataac 38Artificial SequencePrimer gataa aagcatgtcg aactggtact ggctgtat38NAArtificial SequenceSynthetic ca agt aat ccg aac gat aca caa gca gat cga att aag atg gat 48Ser Ala Ser Asn Pro Asn Asp Thr Gln Ala Asp Arg Ile Lys Met Asptg gct caa gct gtg gta ttt act tca caa ggg gta cca ttt atg 96Glu LeuAla Gln Ala Val Val Phe Thr Ser Gln Gly Val Pro Phe Met 2caa ggt gga gaa gaa atg ctg cgg aca aaa ggc ggt aat gat aat agt Gly Gly Glu Glu Met Leu Arg Thr Lys Gly Gly Asn Asp Asn Ser 35 4 aat gcc ggg gat agc gtg aat cag ttc gat tgg tcaaga aaa gca Asn Ala Gly Asp Ser Val Asn Gln Phe Asp Trp Ser Arg Lys Ala 5caa ttt gaa aat gta ttc gac tac tat tct tgg ttg att cat cta cgt 24e Glu Asn Val Phe Asp Tyr Tyr Ser Trp Leu Ile His Leu Arg65 7gat aat cac cca gca ttccgt atg acg aca gcg gat caa atc aaa caa 288Asp Asn His Pro Ala Phe Arg Met Thr Thr Ala Asp Gln Ile Lys Gln 85 9 ctc act ttc ttg gat agc cca acg aac act gta gca ttt gaa tta 336Asn Leu Thr Phe Leu Asp Ser Pro Thr Asn Thr Val Ala Phe Glu Leu aat cat gcc aat cat gat aaa tgg aaa aac att ata gtt atg tat 384Lys Asn His Ala Asn His Asp Lys Trp Lys Asn Ile Ile Val Met Tyr cca aat aaa act gca caa act ctc act cta cca agt gga aat tgg 432Asn Pro Asn Lys Thr Ala Gln Thr Leu ThrLeu Pro Ser Gly Asn Trp att gta gga tta ggc aat caa gta ggt gag aaa tca cta ggc cat 48e Val Gly Leu Gly Asn Gln Val Gly Glu Lys Ser Leu Gly His gta aat ggc acg gtt gag gtg cca gct ctt agt acg atc att ctt cat 528Val AsnGly Thr Val Glu Val Pro Ala Leu Ser Thr Ile Ile Leu His ggt aca tct gaa gat gtc att gat caa aat ccg gaa ccg acc ccg 576Gln Gly Thr Ser Glu Asp Val Ile Asp Gln Asn Pro Glu Pro Thr Pro ccg aac act tcc caa ata aca ttt act gtaaat aac gcc aca acc 624Glu Pro Asn Thr Ser Gln Ile Thr Phe Thr Val Asn Asn Ala Thr Thr 2gg gga caa aat gta tac gtt gtc ggg aat att tcg cag ctg ggg 672Val Trp Gly Gln Asn Val Tyr Val Val Gly Asn Ile Ser Gln Leu Gly 222g gatcca gtc cac gca gtt caa atg acg ccg tct tct tat cca 72p Asp Pro Val His Ala Val Gln Met Thr Pro Ser Ser Tyr Pro225 234g act gta aca atc cct ctt ctt caa ggg caa aac ata caa ttt 768Thr Trp Thr Val Thr Ile Pro Leu Leu Gln Gly Gln AsnIle Gln Phe 245 25a ttt atc aaa aaa gat tca gct gga aat gtc att tgg gaa gat ata 8he Ile Lys Lys Asp Ser Ala Gly Asn Val Ile Trp Glu Asp Ile 267t cga aca tac acc gtc cca act gct gca tcc gga gca tat aca 864Ser Asn Arg Thr TyrThr Val Pro Thr Ala Ala Ser Gly Ala Tyr Thr 275 28c agc tgg aac gtg ccc tag acgcgttaat caataaaaaa acgctgtgcg 9er Trp Asn Val Pro 29gggc acagcgtttt tttgtgtatg gatccgcggc cgcgcgtcaa caatgacctt 975tatgccatat tcttcagcgg ctgcacacatttctttaaat tcttgttcag tacctaagta gttgcca atttgatacg atgtcggctg atacagccag taccagttcg acatgctttt tcctt 94PRTArtificial SequenceSynthetic Construct la Ser Asn Pro Asn Asp Thr Gln Ala Asp Arg Ile Lys Met Aspeu AlaGln Ala Val Val Phe Thr Ser Gln Gly Val Pro Phe Met 2Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly Gly Asn Asp Asn Ser 35 4 Asn Ala Gly Asp Ser Val Asn Gln Phe Asp Trp Ser Arg Lys Ala 5Gln Phe Glu Asn Val Phe Asp Tyr Tyr Ser Trp LeuIle His Leu Arg65 7Asp Asn His Pro Ala Phe Arg Met Thr Thr Ala Asp Gln Ile Lys Gln 85 9 Leu Thr Phe Leu Asp Ser Pro Thr Asn Thr Val Ala Phe Glu Leu Asn His Ala Asn His Asp Lys Trp Lys Asn Ile Ile Val Met Tyr Pro Asn Lys Thr Ala Gln Thr Leu Thr Leu Pro Ser Gly Asn Trp Ile Val Gly Leu Gly Asn Gln Val Gly Glu Lys Ser Leu Gly His Val Asn Gly Thr Val Glu Val Pro Ala Leu Ser Thr Ile Ile Leu His Gly Thr Ser Glu Asp ValIle Asp Gln Asn Pro Glu Pro Thr Pro Pro Asn Thr Ser Gln Ile Thr Phe Thr Val Asn Asn Ala Thr Thr 2rp Gly Gln Asn Val Tyr Val Val Gly Asn Ile Ser Gln Leu Gly 222p Asp Pro Val His Ala Val Gln Met Thr Pro Ser SerTyr Pro225 234p Thr Val Thr Ile Pro Leu Leu Gln Gly Gln Asn Ile Gln Phe 245 25s Phe Ile Lys Lys Asp Ser Ala Gly Asn Val Ile Trp Glu Asp Ile 267n Arg Thr Tyr Thr Val Pro Thr Ala Ala Ser Gly Ala Tyr Thr 275 28a SerTrp Asn Val Pro 29RTArtificial SequenceSynthetic er Leu Ile Arg Ser Arg Tyr Asn His Phe Val Ile Leu Phe Thr -32a Ile Met Phe Leu Thr Val Cys Phe Pro Ala Tyr Lys Ala Leu --5Ala Asp Ser Thr Ser Thr Glu Val Ile Val His TyrHis Arg Phe Asp- Asn Tyr Ala Asn Trp Asp Leu Trp Met Trp Pro Tyr Gln Pro Val 2Asn Gly Asn Gly Ala Ala Tyr Glu Phe Ser Gly Lys Asp Asp Phe Gly 35 4 Lys Ala Asp Val Gln Val Pro Gly Asp Asp Thr Gln Val Gly Leu 5Ile Val ArgThr Asn Asp Trp Ser Gln Lys Asn Thr Ser Asp Asp Leu 65 7 Ile Asp Leu Thr Lys Gly His Glu Ile Trp Ile Val Gln Gly Asp8 95Pro Asn Ile Tyr Tyr Asn Leu Ser Asp Ala Gln Ala Ala Ala Thr Pro Val Ser Asn Ala Tyr Leu Asp Asn Glu LysThr Val Leu Ala Lys Thr Asn Pro Met Thr Leu Ser Asp Gly Ser Ser Gly Phe Thr Val Asp Lys Thr Thr Gly Glu Gln Ile Pro Val Thr Ala Ala Thr Asn Asn Ser Ala Ser Ser Ser Glu Gln Thr Asp Leu Val Gln Leu ThrLeu Ala Ser Ala Pro Asp Val Ser His Thr Ile Gln Val Gly Ala Ala Tyr Glu Ala Val Asn Leu Ile Pro Arg Asn Val Leu Asn Leu Pro 2yr Tyr Tyr Ser Gly Asn Asp Leu Gly Asn Val Tyr Ser Asn Lys 222r Ala Phe ArgVal Trp Ala Pro Thr Ala Ser Asp Val Gln Leu 225 23u Leu Tyr Asn Ser Glu Thr Gly Pro Val Thr Lys Gln Leu Glu Met245n Lys Ser Asp Asn Gly Thr Trp Lys Leu Lys Val Pro Gly Asn Leu 267n Trp Tyr Tyr Leu Tyr Gln Val Thr ValAsn Gly Lys Thr Gln 275 28r Ala Val Asp Pro Tyr Val Arg Ala Ile Ser Val Asn Ala Thr Arg 29et Ile Val Asp Leu Glu Asp Thr Asn Pro Pro Gly Trp Lys Glu 33is Gln Gln Thr Pro Ala Asn Pro Val Asp Glu Val Ile Tyr Glu323l His Val Arg Asp Phe Ser Ile Asp Ala Asn Ser Gly Met Lys Asn 345y Lys Tyr Leu Ala Phe Thr Glu His Gly Thr Lys Gly Pro Asp 355 36n Val Lys Thr Gly Ile Asp Ser Leu Lys Glu Leu Gly Ile Asn Ala 378n Leu Gln ProIle Glu Glu Phe Asn Ser Ile Asp Glu Thr Gln 385 39o Asn Met Tyr Asn Trp Gly Tyr Asp Pro Arg Asn Tyr Asn Val Pro44lu Gly Ala Tyr Ala Thr Thr Pro Glu Gly Thr Ala Arg Ile Thr Gln 423s Gln Leu Ile Gln Ser Ile His Lys AspArg Ile Ala Ile Asn 435 44t Asp Val Val Tyr Asn His Thr Phe Asn Val Gly Val Ser Asp Phe 456s Ile Val Pro Gln Tyr Tyr Tyr Arg Thr Asp Ser Ala Gly Asn 465 47r Thr Asn Gly Ser Gly Val Gly Asn Glu Ile Ala Thr Glu Arg Pro489t Val Gln Lys Phe Val Leu Asp Ser Val Lys Tyr Trp Val Lys Glu 55is Ile Asp Gly Phe Arg Phe Asp Leu Met Ala Leu Leu Gly Lys 5525Asp Thr Met Ala Lys Ile Ser Lys Glu Leu His Ala Ile Asn Pro Gly 534l Leu Tyr GlyGlu Pro Trp Thr Gly Gly Thr Ser Gly Leu Ser 545 55r Asp Gln Leu Val Thr Lys Gly Gln Gln Lys Gly Leu Gly Ile Gly567l Phe Asn Asp Asn Ile Arg Asn Gly Leu Asp Gly Asn Val Phe Asp 589r Ala Gln Gly Phe Ala Thr Gly Asp ProAsn Gln Val Asn Val 595 6le Lys Asn Gly Val Met Gly Ser Ile Ser Asp Phe Thr Ser Ala Pro 662u Thr Ile Asn Tyr Val Thr Ser His Asp Asn Met Thr Leu Trp 625 63p Lys Ile Ser Ala Ser Asn Pro Asn Asp Thr Gln Ala Asp Arg Ile645s Met Asp Glu Leu Ala Gln Ala Val Val Phe Thr Ser Gln Gly Val 667e Met Gln Gly Gly Glu Glu Met Leu Arg Thr Lys Gly Gly Asn 675 68p Asn Ser Tyr Asn Ala Gly Asp Ser Val Asn Gln Phe Asp Trp Ser 69ys Ala Gln PheGlu Asn Val Phe Asp Tyr Tyr Ser Trp Leu Ile 77eu Arg Asp Asn His Pro Ala Phe Arg Met Thr Thr Ala Asp Gln723e Lys Gln Asn Leu Thr Phe Leu Asp Ser Pro Thr Asn Thr Val Ala 745u Leu Lys Asn His Ala Asn His Asp LysTrp Lys Asn Ile Ile 755 76l Met Tyr Asn Pro Asn Lys Thr Ala Gln Thr Leu Thr Leu Pro Ser 778n Trp Thr Ile Val Gly Leu Gly Asn Gln Val Gly Glu Lys Ser 785 79u Gly His Val Asn Gly Thr Val Glu Val Pro Ala Leu Ser Thr Ile88le Leu His Gln Gly Thr Ser Glu Asp Val Ile Asp Gln Asn Pro Glu 823r Pro Glu Pro Asn Thr Ser Gln Ile Thr Phe Thr Val Asn Asn 835 84a Thr Thr Val Trp Gly Gln Asn Val Tyr Val Val Gly Asn Ile Ser 856u Gly Asn TrpAsp Pro Val His Ala Val Gln Met Thr Pro Ser 865 87r Tyr Pro Thr Trp Thr Val Thr Ile Pro Leu Leu Gln Gly Gln Asn889e Gln Phe Lys Phe Ile Lys Lys Asp Ser Ala Gly Asn Val Ile Trp 99sp Ile Ser Asn Arg Thr Tyr Thr Val ProThr Ala Ala Ser Gly 9925Ala Tyr Thr Ala Ser Trp Asn Val Pro 93hermoanaerobacter sp. ly Asn Gln Val Cys Val Arg Phe Val Val Asn Asn Ala Thr Thrrp Gly Glu Asn Val Tyr Leu Thr Gly Asn Val Ala Glu Leu Gly 2AsnTrp Asp Thr Ser Lys Ala Ile Gly Pro Met Phe Asn Gln Val Val 35 4 Gln Tyr Pro Thr Trp Tyr Tyr Asp Val Ser Val Pro Ala Gly Thr 5Thr Ile Glu Phe Ile Lys Lys Asn Gly Ser Thr Val Thr Trp Glu Gly65 7Gly Tyr Asn His Val Tyr Thr Thr Pro ThrSer Gly Thr Ala Thr Val 85 9 Val Asp Trp Gln Pro > * * * * * |
|
|
|