| Patent Number |
Title Of Patent |
Date Issued |
| PP20149 |
New and distinct somaclonal variety of rose scented geranium |
July 7, 2009 |
| A new and distinct somaclone of rose scented geranium Pelargonium graveolens christened `Parimal` characterized by distinct morphology and improved oil yield determining parameters. |
| PP17505 |
Plantago ovata plant named `Mayuri` |
March 20, 2007 |
| This invention relates to a new distinct early maturing, high seed and husk yielding variety of psyllium (Plantago ovata) designated as var. `Mayuri` with the distinct pigment marker of the panicles relatable to the maturity thereby indicating the right harvesting stage to prevent the |
| PP16712 |
Citral rich high yielding lemongrass plant `Nima` of Cymbopogon flexuosus |
June 27, 2006 |
| A new and distinct high essential oil variety of lemongrass (Cymbopogon flexuosus) is named `Nima`. Further, the invention relates to the high content of the monoterpene citral in the essential oil. This novel variety `Nima` of lemongrass is a selection from the open pollinated seedl |
| PP16566 |
Mint plant `Kushal` for late transplanting |
May 23, 2006 |
| The present invention was related to the development of a novel, distinct high yielding plant with rapid regeneration ability obtained through screening of the somaclones in a methodical way for fast regeneration in the tissue culture stage itself which was achieved by inventing the plan |
| PP16474 |
Mint plant named `Cim Indus` |
April 25, 2006 |
| The present invention relates to a new and distinct mint plant of Mentha piperita `Cim Indus`, selected through screening, field trial and analysis of monoterpene constituents of the essential oil of the germplasm, possessing the characters of producing high amount of menthofuran ran |
| PP14538 |
Mint plant named `Sambhav` |
February 17, 2004 |
| The present invention relates to a novel, insect tolerant, high yielding essential oil and menthol yielding mint plant named `Sambhav`, which is a cultivar of Mentha arvensis L.. The mint plant of the present invention has been developed as a result of planned experiments which devised a |
| PP13336 |
High yielding and stable plant of Cymbopogon flexuosus called `Chirharit` |
December 10, 2002 |
| The present invention is related to the development of a new and chromosomally distinct vegetatively propagated frost resisted plant of Cymbopogon flexuosus by genetic selection in open pollinated seed progeny of high yielding variety `Cauvery`. The selected plant with stay-green hab |
| PP13279 |
Mint plant named `Saksham` |
November 26, 2002 |
| This invention relates to a new and distinct mint plant of Mentha arvensis `Saksham`, developed through tissue culture, possessing the following combination of characters namely producing higher amount of menthol with high essential oil yield as well as herbage yield; possessing better |
| PP13203 |
High yielding stable plant of Rosa damascena, called `Ranisahiba` |
November 12, 2002 |
| The invention provides a novel half-sib damask rose progeny christened as `Ranisahiba` and characterized by its doubled per se oil content and oil yield, high flower biomass with synchronous flowering and firmly fixed morphophysiological plant-traits. |
| PP12997 |
`Jal Pallavi`, water logging tolerant Cymbopogon winterianus |
September 24, 2002 |
| The present invention is related to the development of a new and distinct vegetatively propagated water tolerant plant of Cymbopogon winterianus by selection of a somatic variant from high yielding line Jorlab-2, the selected plant withstands prolonged water stagnation with no reduction |
| PP12791 |
Novel, high yielding stable Mentha arvensis plant named `Damroo` |
July 23, 2002 |
| A novel Mentha arvensis mint population-variety `Damroo` capable of producing viable seeds and phenotypically homogeneous seed-derived plant population when cross pollinated within its own population and capable of high yield of mint oil. |
| PP12426 |
Mint plant named `Kosi` |
February 26, 2002 |
| A novel mint plant `Kosi` characterized by its high menthol content, high biomass and high oil yield with symmetrical branching giving globular shape to the canopy for equal distribution of sunlight to the lower leaves. |
| PP12030 |
Hybrid mint plant named `Neerkalka` |
August 7, 2001 |
| The present invention relates to the development of a new and distinct interspecific mint hybrid `Neerkalka` developed by sexual crossing between improved Mother plant Mentha arvensis (cv Kalka) and pollen plant Mentha spicata (cv Neera), which hybrid is propagated vegetatively by sucker |
| 7527814 |
Process for the isolation of calliterpenone |
May 5, 2009 |
| The invention provides a simple method for isolation of calliterpenone (16.alpha.,17 dihydroxy-3-oxo phyllocladane), a phyllocladane diterpenoid with the plant growth regulating properties, from plant genus Callicarpa. |
| 7510836 |
Alpha arteether resistance domain |
March 31, 2009 |
| The present invention relates to an alpha-arteether resistance domain (ADR) of Sequence ID No.1 and a method of identifying ADR in alpha-arteether resistant pathogens and lastly, it relates to set three pairs of primers of sequence ID Nos. 3 to 8. |
| 7473768 |
Primers and a screening method for identification of artemisinin producing plants |
January 6, 2009 |
| The present invention relates to a pair of primers with forward primer of SEQ ID NO. 1 having sequence of CCAAGCTTGCTGAACGCATCGG, and reverse primer of SEQ ID No. 2 having sequence of CCAAGCTTGCCACGCAGGATTATC, and a screening method for early identification of plants Artemisia annua |
| 7435433 |
Process for the isolation of oleane compounds isolated from the bark of arjun tree terminalia ar |
October 14, 2008 |
| The present invention provides an improved process for the isolation of oleane compounds from the bark of Terminalia arjuna (Roxb.). More particularly, the present invention relates to an improved process for the isolation of arjunic acid and its derivates from the bark of Terminalia |
| 7262004 |
Screening method for selection of insect tolerant plants |
August 28, 2007 |
| An in vitro screening method for identifying insect tolerant genotypes or clones is described. The method comprises growing plantlets in an in vitro system, screening the plantlets for molecular variation of somaclones using RAPD analysis in vitro, selecting the somaclones having mol |
| 7235262 |
Use of bioactive fraction from cow urine distillate (`Go-mutra`) as a bio-enhancer of anti-infec |
June 26, 2007 |
| The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and |
| 7211428 |
Strain of Bacillus as a bioinoculant |
May 1, 2007 |
| The present invention relates to the selection and development of superior strain of Bacillus spp for improving plant growth and health by inhibiting pathogenic fungi. |
| 6979471 |
Composition comprising pharmaceutical/nutraceutical agent and a bio-enhancer obtained from Glycy |
December 27, 2005 |
| The invention relates to a new use of a non-alkaloid compound that is plant derived glycoside `glycyrrhizin` as a highly potent bio-enhancer of activity and availability of antibiotics and other drugs including anti-infective and anticancer agents. The molecule of invention facilitat |
| 6896907 |
Use of bioactive fraction from cow urine distillate (`go-mutra`) as a bio-enhancer of anti-infec |
May 24, 2005 |
| The invention relates to a novel pharmaceutical composition comprising an effective amount of bio-active fraction from cow urine distillate as a bioavailability facilitator and pharmaceutically acceptable additives selected from anticancer compounds, antibiotics, drugs, therapeutic and |
| 6884908 |
Process for isolation of hepatoprotective agent "oleanolic acid" from Lantana camera |
April 26, 2005 |
| Accordingly the present invention provides an improved and economical process for the isolation of oleanolic acid from the roots of Lantana camara, which comprises of drying, grinding and defattening of Lantana camara roots with light petroleum followed by over night extractions at r |
| 6858588 |
Nitrile glycoside useful as a bioenhancer of drugs and nutrients, process of its isolation from |
February 22, 2005 |
| The present invention relates to a novel nitrile glycoside of Formula I named NIAZIRIDIN and to analogues and derivatives thereof. The present invention also relates to a process for the isolation of a novel nitrile glycoside of Formula I below named NIAZIRIDIN and its derivatives and |
| 6833143 |
Process for the preparation of a extract rich in bacosides from the herb Bacopa monniera |
December 21, 2004 |
| The present invention provides a novel process for the preparation of bacosides enriched fraction in a non-hygroscopic form the extract of Bacopa monniera, the said process comprising the steps of drying freshly harvested herb in a hot air oven at 37-42.degree. C., powdering and siev |
| 6831100 |
Menthyl benzoate formulations for external UV protection |
December 14, 2004 |
| The present invention describes a novel and very quick bacterial system based screening protocol to detect UV protectant molecules and determining their efficacy for the extent of protection against Ultraviolet radiation in biological systems, identifying a new use of the compound menthy |
| 6824795 |
Formulation comprising thymol useful in the treatment of drug resistant bacterial infections |
November 30, 2004 |
| A formulation useful in the treatment of drug resistant bacterial infections comprising an effective amount of thymol obtained from the plant Trachyspermum ammi, mint oil containing an appropriate amount of monoterpenes obtained from a hybrid of Mentha spicata and Mentha arvensis, an |
| 6685972 |
Process for isolating artemisinin from Artemisia annua |
February 3, 2004 |
| The present invention relates to a process for the isolation of artemisinin, an antimalarial agent from the herb of the Artemisia annua plant, comprising of extracting the herb with ethanol, partitioning of the extract between water and hexane, followed by evaporative crystallization |
| 6683193 |
Single pot conversion of artemisinin into artemether |
January 27, 2004 |
| The present invention relates to an improved method for the preparation of Artemether. Artemether prepared from the process is useful for the treatment of uncomplicated, severe complicated and multi drug resistant malaria. |
| 6676974 |
Bioactive hexane fraction from Vetiveria zizanioides |
January 13, 2004 |
| The present invention relates a hexane bioactive fraction and obtained from the roots of an aromatic plant named Vetiveria zizanioides commonly found in India for inhibiting the growth of drug resistant bacterial infections in humans and animals; also relates to a pharmaceutical composit |
| 6660761 |
Method of treatment for fungal infections with a synergistic formulation of antifungal agents |
December 9, 2003 |
| The present invention relates to a method of treatment of fungal infections consisting essentially of a synergistic combination of plant compounds that are useful for enhancing the activity of antifungal compounds. The plant compounds, menthol and menthyl acetate, when mixed at specific |
| 6623766 |
Process for insecticidal formulation effective in controlling malarial vector, mosquitoes |
September 23, 2003 |
| The present invention relates to a new herbal synergistic formulation, comprising essential oil of medicinal plant Foeniculum vulgare and other plants and said formulation useful as insecticide against mosquito larvae; in addition, the formulation of the present invention has toxic actio |
| 6558940 |
Streptomyces strain with potential anti-microbial activity against phytopathogenic fungi |
May 6, 2003 |
| The present invention relates to a new strain of Streptomyces sp., called CIMAP A.sub.1 isolated from the soil of geranium (Pelargonium graveolens) planted in the experimental fields of CIMAP and having the accession No. ATCC PTA-4131 and capable of inhibiting the growth of phytopathogen |
| 6548746 |
`Dhawal`, a high alkaloid producing periwinkle plant |
April 15, 2003 |
| The invention relates to the development of a new and distinct mutant `Dhawal` of periwinkle, Catharanthus roseus, produced by chemical mutagen treatment of the seeds followed by rigorous selection in a widely cultivated variety `Nirmal` of Catharanthus roseus, said plant being stabl |
| 6534696 |
Method of producing a poppy plant |
March 18, 2003 |
| The invention relates to a disease resistant and high yielding variety of opium poppy plant (Papaver somniferum L. 2n=22) christened as `Rakshit`. |
| 6514541 |
Formulation comprising thymol useful in the treatment of drug resistant bacterial infections |
February 4, 2003 |
| A formulation useful in the treatment of drug resistant bacterial infections comprising an effective amount of thymol obtained from the plant Trachyspermum ammi, mint oil containing an appropriate amount of monoterpenes obtained from a hybrid of Mentha spicata and Mentha arvensis, an |
| 6511821 |
Process for the preparation of novel growth media from distillation and other plant wastes for m |
January 28, 2003 |
| A process for the preparation of a growth media for mass multiplication of bio-control fungi, comprising a chopped, shade-dried distillation waste in a plastic bag that is plugged with cotton followed by autoclaving and an inoculation of a strain of bio-control fungi such as Trichoderma |
| 6455079 |
Process of its application against lepidopteran insects using Albizzia lebbeck plant extract and |
September 24, 2002 |
| The present invention provides a novel synergistic composition comprising extract obtained from the plant Albizzia lebbeck together with Bacillus thuringiensis .delta.-endotoxin, useful in controlling lepidopteran insects, methods for the preparation of the composition and application of |
| 6451356 |
Antibacterial composition comprising oenostacin from oenothera biennis |
September 17, 2002 |
| The present invention provides a pharmaceutical composition for treating bacterial infections in patients comprising an effective amount of 3.5-dihydroxy-4-pent-4'-enoyl-1'-oxymethylbenzoic acid (Oenostacin) isolated from Oenothera biennis. |
| 6423741 |
Anti-microbial composition and method for producing the same |
July 23, 2002 |
| This invention is related to the development of strategic and novel composition comprising .alpha. arteether and nalidixic acid or quinolone drugs, said composition useful as an advanced generation drug to counter the resistance development itself and having a potential to be used in |
| 6423541 |
Process for in vitro selection of high methol producing genotypes |
July 23, 2002 |
| The invention provides a rapid in vitro method for selection of menthol rich mint genotypes from a large population of independent clones, said method comprising the steps of (i) raising a heterogeneous population of Mentha arvensis clones in vitro or by vegetative methods, (ii) tran |
| 6420174 |
Method of producing organogenetic tissue from a plant of the genus Mentha |
July 16, 2002 |
| The present invention is related to a method of producing organogenetic tissues from a plant of the genus Mentha, said method comprising the steps of culturing an explant from a plant of genus Mentha on an initiation medium in the presence of 400 to 600 lux light at a temperature of |
| 6410059 |
Pharmaceutical composition containing cow urine distillate and an antibiotic |
June 25, 2002 |
| A pharmaceutical composition comprising an antibiotic and cow urine distillate in an amount effective to enhance antimicrobial effect of the antibiotic is disclosed. The antibiotic can be an antifungal agent. The antibiotic can be a quinolone or a fluoroquinolone. The antifungal agent |
| 6393763 |
Method for maximization of artemisinin production by the plant artemisia annua |
May 28, 2002 |
| The invention provides a method for maximization of artemisinin yield of the plant Artemisia annua, said method comprising sowing seeds of Artemisia annua plant on raised bed nursery during second and third week of December and maintaining the moisture throughout; transplanting seedl |
| 6365197 |
Antibacterial composition comprising Oenostacin from Oenothera biennis |
April 2, 2002 |
| The present invention provides a pharmaceutical composition for treating bacterial infections in patients comprising an effective amount of 3,5-dihydroxy-4-pent-4'-enoyl-1'-oxymethylbenzoic acid (Oenostacin) isolated from Oenothera biennis. |
| 6336949 |
Slow release urea fertilizer composition and a process for the preparation of the said compositi |
January 8, 2002 |
| A novel composition for a slow release nitrogenous fertilizer comprising about 0.5-1% of an inert material, 0.5-1% of essential oil or their derivatives on w/w basis and process for the preparation of the composition. |
| 6127405 |
Method for the use of alpha arteether as an anti-bacterial and anti-fungal agent |
October 3, 2000 |
| The present invention relates to use .alpha.-arteether as a antibacterial agent, preferably for gyr mutant bacteria which are resistant to quinolone drugs and can be used as therapeutic agents for treating drug resistant bacterial infections, and also as a antifungal agent. |
