Resources Contact Us Home
Council of Scientific Industrial Research Patents
Council of Scientific Industrial Research
New Delhi, IN
No. of patents:

1 2 3 4 5 6 7 8

Patent Number Title Of Patent Date Issued
PP17505 Plantago ovata plant named `Mayuri` March 20, 2007
This invention relates to a new distinct early maturing, high seed and husk yielding variety of psyllium (Plantago ovata) designated as var. `Mayuri` with the distinct pigment marker of the panicles relatable to the maturity thereby indicating the right harvesting stage to prevent the
PP16712 Citral rich high yielding lemongrass plant `Nima` of Cymbopogon flexuosus June 27, 2006
A new and distinct high essential oil variety of lemongrass (Cymbopogon flexuosus) is named `Nima`. Further, the invention relates to the high content of the monoterpene citral in the essential oil. This novel variety `Nima` of lemongrass is a selection from the open pollinated seedl
PP14400 Rose scented geranium pelargonium graveolenes plant `Safal` December 23, 2003
The invention relates to a new, distinct and unique plant of rose scented geranium Pelargonium graveolens `Safal` derived from a rare seed-set in cultivar `Bipuli,` apparently the result of hybridization between largely sterile populations of the cultivar accessions `Bipuli` and `Hemanti
PP14090 Peppermint plant named `Pranjal` August 26, 2003
Described as a new Peppermint mutant having a high yield of menthol rich essential oil, deep purplish green foliage, purplish white flowers, a delayed temporary wilting point and tolerance to the pest Bihar hairy caterpillar (Spilarctia obliqua).
PP12997 `Jal Pallavi`, water logging tolerant Cymbopogon winterianus September 24, 2002
The present invention is related to the development of a new and distinct vegetatively propagated water tolerant plant of Cymbopogon winterianus by selection of a somatic variant from high yielding line Jorlab-2, the selected plant withstands prolonged water stagnation with no reduction
PP12791 Novel, high yielding stable Mentha arvensis plant named `Damroo` July 23, 2002
A novel Mentha arvensis mint population-variety `Damroo` capable of producing viable seeds and phenotypically homogeneous seed-derived plant population when cross pollinated within its own population and capable of high yield of mint oil.
PP10935 Mini plant Mentha arvensis `Himalaya` June 1, 1999
A new and distinct hybrid plant named `Himalaya` (Mentha arvensis) characterized by its higher yield of oil which is rich in menthol, improved regeneration potential, vigorous growth, deep green broad thick leaves, pinkish white flowers and tolerance to rust such as alternaria leaf b
8587414 Wireless information and safety system for mines November 19, 2013
The wireless information and safety system for mines of the present invention enables continuously tracking and monitoring underground miners and moveable equipment in underground mines using ZigBee-enabled active RFID devices forming a wireless network among them and other static and
8586151 Process for the preparation of photoluminescent nanostructured silicon thin films using radio fr November 19, 2013
A process for the preparation of nano structured silicon thin film using radio frequency (rf) plasma discharge useful for light emitting devices such as light emitting diode, laser etc. which allows precise control of the nanocrystal size of silicon and its uniform distribution without
8563306 Tumor model system useful to study multistage cancer October 22, 2013
The present invention relates to a method of developing a Tumor Model System. The invention deals with a tumor model system with adhesion deprived cells. This observation provides a new method for primary detection of transformation of adhesion-deprived cells and tumorigenicity. The
8563215 Diazonaphthoquinonesulfonic acid bisphenol derivative useful in photo lithographic sub micron pa October 22, 2013
The present invention provides novel diazonaphthoquinonesulfonic acid bisphenol derivatives. More particularly, the present invention relates to photo restive coating comprising alkali-soluble resin, a photoactive compound and a surfactant. The photoresist film prepared has less then
8288387 Napthalimide-benzimidazole hybrids as potential antitumor agents and process for the preparation October 16, 2012
The present invention provides the compounds of general formula 5 and 9 useful as potential antitumour agents against human cancer cell lines. The present invention further provides the process for preparation of napthalimide-benzimidazole hybrids of general formula 5 and 9, n-1-2, R
8283173 Process utilizing natural carbon-13 isotope for identification of early breakthrough of injectio October 9, 2012
This invention relates to a process utilizing natural carbon-13 isotope for identification of early breakthrough of injection water in oil wells. All natural water sources are labeled by unique ratios of carbon isotopes (.sup.13C/.sub.12C). Following the requirements of the invention, th
8278483 Process for synthesis of glycomimicking cationic amphiphiles October 2, 2012
The present invention provides processes for the synthesis of novel Shikimic acid head-group containing non-toxic cationic amphiphiles capable of facilitating transport of biological macromolecules into cells.
8277690 Conducting copolymer ferromagnetic composite and a process for the preparation thereof October 2, 2012
The present invention provides a conducting copolymer ferromagnetic composite. Particularly, the present invention relates to a conducting copolymer of aniline and ethylene-dioxy thiophene containing ferrite particles. The present invention also provides insitu polymerization of anil
8268983 Primers for amplifying and detecting the beta 2 adrenergic receptor gene September 18, 2012
Present invention relates to a method for predicting an individual's bronchodilatory response to a .beta. agonist. Present invention particularly relates to the detection of specific allelic variants of the .beta.2AR gene and their use as pharmacogenetic markers towards response to .
8268600 Strain and a novel process for ethanol production from lignocellulosic biomass at high temperatu September 18, 2012
The present invention relates to a novel thermophilic ethanol producing yeast strain, a microorganism, Kluyveromyces sp. IIPE453 MTCC 5314, classified as yeast, which exhibits growth and sugar fermentation at higher temperature range between C. to C. The novel y
8257486 Composition for building material and a process for the preparation thereof September 4, 2012
The present invention provides a composition and a process for the preparation of chemical activated cold setting fly ash building construction materials. The chemical activator is an alkaline aqueous solution of 11.2 to 13.6 in pH and 1.25 to 1.40 gm/cc in density which contains adm
8252359 Method for the preparation of refreshing drink and use thereof August 28, 2012
The present invention discloses a nutritious, tasty and affordable drink made from the sap of Kappaphycus alvarezii seaweed which is readily cultivable. The drink resembles coconut water in appearance and taste and is rich in potassium. It also contains an adequate proportion of the
8252261 Process for the preparation of finely divided precipitated silica August 28, 2012
The present invention provides a process for the preparation of finely divided precipitated silica. Finely divided precipitated silica is prepared by neutralization of alkali silicate solution, under continuous stirring, at to C. in presence of alkali metal salt
8242051 Carbon supported activated alumina absorbent useful for the removal of fluoride ions from water August 14, 2012
The present invention provides a novel adsorbent carbon supported activated alumina (CSAA) which posses both the advantageous characteristics of carbon and alumina viz., the high specific surface area associated with activated carbon and high sorption capacity of alumina towards
8241483 Process for the preparation of stable iodate-exchanged synthetic hydrotalcite with zero effluent August 14, 2012
The present invention relates to a process for the preparation of stable iodate-exchanged hydrotalcite with zero effluent discharge. The iodate-exchanged hydrotalcite produced is useful as iodizing agent. The invention further relates to utilization of alkaline effluent generated in
8236840 Thiopene containing analogues of fluconazole as antifungal agents and process for their preparat August 7, 2012
The present invention discloses novel compounds of the Formula (1), containing thiophene moieties and pharmaceutically acceptable salts thereof, methods for preparing these compounds, the use of these compounds in prevention and treatment of fungal infections, and pharmaceutical prep
8227220 Process for the preparation of ethanol from starch July 24, 2012
The present invention provides a process for the preparation of ethanol from starch. Specifically, the present invention provides a process for the preparation of ethanol from starch such as tapioca, potato, sweet sorghum, rice by liquification and saacharification of starch and subs
8217167 Phenanthrylphenol linked pyrrolo [2, l-c] [l, 4] benzodiazepine hybrids as potential antitumour July 10, 2012
The present invention provides a compounds of general formula (6), useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo[2,1-c][1,4]benzodiazepine hybrids of general formula (6).
8182784 Process for the time recovery of sulphate of potash (SOP) from sulphate rich bittern May 22, 2012
The present invention relates to a process for the recovery of sulphate of potash (SOP) from bittern. Kainite is obtained by fractional crystallization of the bittern. Kainite is converted into schoenite with simultaneous removal of NaCl and the filtrate (SEL) is used for production
8178356 Method for evaluation of performance of percolation tanks using environmental chloride as a trac May 15, 2012
Naturally present chloride concentration in natural water is utilized for the development of the technique to gauge the performance of percolation tanks in space and time. The chloride mass balance technique is simple, sensitive, reliable and yet powerful enough to resolve the temporal
8153627 Quinazoline linked pyrrolo[2,1-C][1, 4]benzodiazepine hybrids as potential anticancer agents and April 10, 2012
The present invention provides a compound of general formula 5, useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo[2,1-c][1,4]benzodiazepine hybrids of general formula (5): wherein n=3
8148118 Method of inducing chirality to epoxides using 2,3:4,6 di-O-isopropylidene-2-keto-L-gulonic acid April 3, 2012
The present invention relates to a recyclable method to prepare chirally pure epoxides directly from olefins using a novel chiral acid 2,3:4,6-di-O-isopropylidene-2-keto-L-gulonic acid monohydrate as chiral inducer and anhydrous hydrogen peroxide in the form of urea hydrogen peroxide
8140309 Method of predicting the dynamic behavior of water table in an anisotropic unconfined aquifer ha March 20, 2012
The present invention relates to development of a method of predicting the dynamic behavior of water table in an anisotropic unconfined aquifer having a general time-varying recharge rate from multiple rectangular recharge basins. Each basin can have a different dimension and nature of
8129369 Antifungal compounds containing benzothiazinone, benzoxazinone or benzoxazolinone and process th March 6, 2012
The present invention discloses novel compounds of the Formula (1), comprising benzothiazinone, benzoxazinone or benzoxazolinone moieties having antifungal activity, method for preparing these compounds and the use of these compounds as antifungal agents in prevention and treatment o
8097447 Solid nutrient media useful for isolating and identifying alkaliphilic bacteria January 17, 2012
The present invention relates to a solid nutrient media composition having alkaline pH, useful for isolating and identifying alkaliphilic microorganisms in pure form. The media composition consists of 5-15 g of carbon source, 2.5-10 g of peptone, 2.5-10 g of yeast extract, 0.5-1.5 g
8093004 Method of detecting and predicting bronchodilatory response to beta agonist January 10, 2012
Present invention relates to a method for predicting an individual's bronchodilatory response to a .beta. agonist. Present invention particularly relates to the detection of specific allelic variants of the .beta.2AR gene and their use as pharmacogenetic markers towards response to .
8063204 Benzothiazole and benzoxazole linked pyrrolo[2,1-c] [1, 4] benzodiazepine hybrids as novel antit November 22, 2011
The present invention provides a compound of general formula (9), useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo[2,1-c][1,4][benzodiazepine g hybrids of general formula (9). ##STR0
8021442 Process for the preparation of common salt of high purity from brines in solar salt pans September 20, 2011
The process of the invention is an improvement over the existing process of producing salt of high purity from alum-treated brine disclosed recently in the prior art. More particularly, the invention rectifies the ratio of Ca.sup.2+ to Mg.sup.2+ from a value <1 to a value in the r
8012952 Cationic 17 .alpha.-substituted-estradiol derivatives useful as anti-cancer agent September 6, 2011
The present invention provides a novel series of cationic, lipid-based, 17.alpha.-substituted-estradiol derivatives. The present invention further provides a process for the preparation of a novel series of 17.alpha.-substituted-estradiol derivatives. The invention also provides info
7982074 Process for the preparation of 1,1,1,2-tetrafluoroethane July 19, 2011
The present invention relates to a process for preparing a co-precipitated Cr.sub.2O.sub.3/Al2O.sub.3 catalyst promoted by Zinc, said process comprising co-precipatation of chromium and aluminum metal hydroxides from corresponding trivalent metal salt solutions using NH4OH, NaOH or K
7960418 4.beta.-amino podophyllotoxin congeners as potential anticancer agents and a process for the pre June 14, 2011
The present invention provides new class of 4.beta.-[4''-(1'',3''-benzothiazole-2''-yl)anilino]podophyllotoxin analogues having the structural formula as follows (4). ##STR00001## Where R.dbd.H or CH.sub.3; R.sub.1.dbd.H, halogen, CH.sub.3 and R.sub.2.dbd.H, halogen, OCH.sub.3. The
7940601 Method for computing an exact impulse response of a plane acoustic reflector at zero offset due May 10, 2011
Originating from a novel and an exact algebraic formula for the impulse response of a plane acoustic reflector at zero offset due to a point acoustic source the present invention provides a method for computing an exact impulse response of a plane acoustic reflector at zero offset due
7912272 Fake document including fake currency detector using integrated transmission and reflective spec March 22, 2011
A currency genuineness detection system using plurality of opto-electronic sensors with both transmission and reflective (including fluorescence) properties of security documents is developed. Both detection sensing strategies utilize integrated response of the wide optical band sensed
7879371 Caffeine fraction obtained from tea leaves and a method for inducing Agrobacterium tumefaciens-m February 1, 2011
The present invention relates to a thermolabile caffeine fraction useful for an efficient Agrobacterium-mediated genetic transformation in plant systems to develop desired traits in plant, and a method of preparing said fraction from tea leaves and also, an efficient and cost-effective
7872160 Single pot process for the regioselective synthesis of neolignan framework asarones January 18, 2011
The present invention provides a single pot process for the regioselective synthesis of neolignan framework [3(R)-Ethyl-2(S)-methyl-3-(2'',4'',5''-trimethoxyphenyl)-1-(2',4',5'-trim- ethoxyphenyl)propane from toxic .beta.-isomer rich asarone using montmorillonite acidic clay by employ
7871657 Process for preparation of expanded millet January 18, 2011
The present invention relates to a process for preparation of expanded finger millet, a ready-to-eat product with versatile food uses.
7842653 Process for the preparation of lubricants November 30, 2010
The present invention provides an improved process for the preparation of lubricants from vegetable oil or fat obtained from animal source. The present invention involves a reaction of vegetable oil or fat with an alcohol in the presence of a double metal cyanide catalyst, at a tempe
7825230 Human microRNA targets in HIV genome and a method of identification thereof November 2, 2010
The present invention relates to human microRNA targets in HIV genome and a method of identification thereof. Using multiple software targets to six human microRNAs [miRNAs] were discovered in the net, vpr, env, and I vif genes. The miRNAs were identified as hsa-miR-29a, hsa-miR-29b,
7820859 Process for preparing L- (+) -lactic acid October 26, 2010
The present invention provides a commercially viable process for the preparation of highly pure and optically active L-(+)-lactic acid and S-(-)-methyl lactate, in high yield, obtained from esterification of aqueous crude lactic acid solution produced by sugar cane juice fermentation
7816119 Chemoenzymatic process for the stereoselective preparation of (R)-.gamma.-amino-.beta.-hydroxybu October 19, 2010
The present invention provides a chemoenzymatic process for the preparation of (R)-GABOB and (R)-carnitine employing lipase-mediated resolution of 3-hydroxy-4-tosyloxybutanenitrile as the key step. The drawing accompanying this specification represents the preparation of racemic 3-hy
7811535 Process for the preparation of magnesia (MGO) October 12, 2010
The present invention provides an improved process for the preparation of MgO of high purity >99% from salt bitterns via intermediate formation of Mg(OH).sub.2 obtained from the reaction of MgCl.sub.2 and lime, albeit indirectly, i.e., MgCl.sub.2 is first reacted with NH.sub.3 in aque
7803526 Development of diagnostic kit for the detection of Chrysanthemum virus B September 28, 2010
The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnostic kit useful for detect
7781622 Process for direct hydroxylation of aromatic hydrocarbons August 24, 2010
The present invention provides a process for direct hydroxylation of aromatic hydrocarbons like benzene to phenol, toluene to cresols and anisole to methoxy phenols by using hydrogen peroxide as environmentally benign oxidant in polar solvent like acetonitrile using vanadium phthaloc
1 2 3 4 5 6 7 8

  Recently Added Patents
System and method for testing an integrated circuit embedded in a system on a chip
Modulation of HSP47 expression
Image processing apparatus, remote management system, license update method, and computer program product
Liquid crystal display device
System and method for providing location and access network information support in a network environment
Multilayered ceramic electronic component and fabrication method thereof
  Randomly Featured Patents
Power demand management method and system
Process and system for precision glass sheet bending
Method for preparing thin layers
Self-deicing windshield wiper
Measurement of attention span and attention deficits
Electrochemical cell
Programmable instruction trap system and method
Heat recovery system for forced air furnaces
Deformable toothbrush
Olefin aromatization process